Warm Up: Put your homework in the basket. Get everything else off of your desk.

1. Which of the following is a nucleotide found in DNA? Ribose + phosphate group + thymine Ribose + phosphate group + uracil Deoxyribose + phosphate group + uracil Deoxyribose + phosphate group + cyotsine

2. DNA replication results in two DNA molecules, Each with two new strands. Each with two new strands and the other with two original strands. Each with one new strand and one original strand. Each with two original strands.

3. During DNA replication, a DNA strand that has the bases CTAGGT produces a strand with the bases TCGAAC GATCCA AGCTTG GAUCCA

4. What happens during the process of translation? Messenger RNA is made from DNA. The cell uses information from messenger RNA to produce proteins. Transfer RNA is made from messenger RNA. Copies of DNA molecules are made.

5. How many codons are needed to specify three amino acids? 3 6 9 12

6. What is produced during transcription? RNA molecules DNA molecules RNA polymerase proteins

7. During translation, the type of amino acid that is added to the growing polypeptide depends on the Codon on the tRNA only. Anticodon on the mRNA only. Anticodon on the tRNA to which the amino acid is attached only. Codon on the mRNA and the anticodon on the tRNA to which the amino acid is attached.

8. Genes contain instructions for assembling Purines Nucleosomes Proteins Pyrimidines

9. Which of the following are found in both DNA and RNA? Ribose, phosphate groups, and adenine Deoxyribose, phosphate groups, and guanine Phosphate groups, guanine, and cytosine Phosphate groups, guanine, and thymine

10. Why is it possible for an amino acid to be specified by more than one kind of codon? Some codons have the same sequence of nucleotides. There are 64 different kinds of codons but only 20 amino acids. Some codons do not specify an amino acid. The codon AUG codes for the amino acid methionine and serves as the “start” codon for protein synthesis.

11. RNA contains the sugar Ribose Deoxyribose Glucose Lactose

12. Unlike DNA, RNA contains Adenine Uracil Phosphate groups Thymine

13. Which type(s) of RNA is(are) involved in protein synthesis? Transfer RNA only Messenger RNA only Ribosomal RNA and transfer RNA only Messenger RNA, ribosomal RNA, and transfer RNA

14. Which type of RNA functions as a “blueprint” for protein synthesis? rRNA tRNA mRNA RNA polymerase

15. When a mutation involves the addition of a base early in the coding sequence (near the beginning), the translated protein is likely to be: Functionally disrupted by the mutation Functionally enhanced by the mutation Functionally unaffected by the mutation Composed of amino acids largely normal in their sequence Prematurely terminated

16. Which of the following changes in DNA would you expect to have the greatest effect on the protein it codes for? 1 2 3 Start End  ATCGAGCGGCTGATCATTAGT Substitution of base at 1 Deletion of base at 1 Deletion of base at 2 Addition of base at 3 Substitution of base at 3