Mutation CAUSES: Definition:

Slides:

Advertisements

Similar presentations

Mutations. What Are Mutations? Changes in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring, only to descendant cells)

Advertisements

Chapter 14 Sec 1: Genes in Action

Genetic Mutations. Mutation: An unpredictable change in the genetic material of an organism Gene Mutation: A change in the structure of a DNA molecule,

Human Genetic Mutations. 2 Main Types of Mutations 1.) Chromosomal Mutations 2.) Gene Mutations.

 Mutation – any change in DNA sequence  Can be caused by errors inside the cell ◦ Errors in  Replication  Transcription  Cell division (mitosis,

Mutations Germ Cell vs. Somatic Cell.  Gene Mutation: affects either one nucleotide or one codon  Substitution: one nucleotide is replaced with a different.

Definition : Any change in the nucleotide sequence of DNA.

Mutations  Mutations are defined as “a sudden genetic change in the DNA sequence that affects genetic information”.  They can occur at the molecular.

Gene Mutations Chapter 11.

MUTATIONS How mistakes are made…. Mutations  Mutations are defined as “a sudden genetic change in the DNA sequence that affects genetic information”.

Mutation – any change in DNA. Mutations Mutations are defined as “a sudden genetic change in the DNA sequence that affects genetic information”. They.

Ch Mutations Section Objectives: Categorize the different kinds of mutations that can occur in DNA. Compare the effects of different kinds of mutations.

So Mutations!  Any change to the quantity or structure of DNA of an organism is known as a mutation.  Mutations can occur in either somatic cells (body.

Human Genetic Mutations. 2 Main Types of Mutations 1.) Chromosomal Mutations 2.) Gene Mutations.

GENETIC MUTATIONS What is this picture depicting?.

G. Gene Mutations: 1.Mutation- 2. Mutations may be caused by errors in replication or by mutagens. Mutagen- may lead to the production of an abnormal protein.

DNA Mutations & Disorders

May occur in somatic cells (aren‘t passed to offspring)

MOLECULAR GENETICS Mutations Definition

Human Genetic Mutations

Human Genetics-Mutations

(4) Genes and proteins in health and disease

Mutations and Nature vs. Nurture.

Lecture 55 Mutations Ozgur Unal

GENETIC MUTATIONS Section 5.6 Pg. 259.

Gene Mutations Chapter 11.

Chromosomes, Genes, Alleles and Mutations

Human Genetic Mutations

Human Genetic Mutations

Errors in DNA Mutations.

Mutation Lecture 11 By Ms. Shumaila Azam

DNA and Mutations.

Chapter 13: Genes & Chromosomes

Germ Cell vs. Somatic Cell

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations -changes in a single base pair in DNA=changes in the nucleotide.

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations Alternative alleles (traits) of many genes result from changes.

Changes in the nucleotide sequence of DNA or mRNA

Human Genetic Disorders

Human Genetic Mutations

Mutations A mutation is any change in the DNA sequence.

Mutations Ms MacCormack Fall 2018.

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?

Mutation Three CAUSES: Definition: Is a permanent change in DNA.

Mutations A mutation is any change in the DNA sequence.

Human Genetic Mutations

AIM: How do mutations occur in DNA ?

1) Base Mutations 2) Chromosomal Mutations

Mutations: The Basis of Genetic Change

Germ Cell vs. Somatic Cell

Objective: Explain the main types of mutations

Copyright Pearson Prentice Hall

Mutations: Changes in Genes

Presentation transcript:

Mutation CAUSES: Definition: change in organism resulting from change in gene structure CAUSES: 1. Errors in DNA replication: nucleotides lost, rearranged, paired wrong 2. Mutagen: internal or external factor causing mutation Chemical mutagens: dioxins, benzene, asbestos, DDT, cigarette smoke Radioactive Mutagens: UV rays, X-rays 3. Transposons: DNA sequence capable of randomly moving from one site to another in another in the genome

Gene Mutations Frameshift Mutations (English Sentence Analogy): Original: BIG DOG BIT TED Addition: BIG DOG BBI TTE D Deletion: IGD OGB ITT ED Substitution: BIG JOG BIT TED Point Mutations: Silent: DNA=ACA→ACG, mRNA=UGU→UGC, AA=Cys →Cys Missense: DNA=ACA→ACC, mRNA=UGU→UGG, AA= Cys→ Trp Nonsense: DNA=ACA→ACT, mRNA=UGU→UGA, AA=Cys→STOP

Genetic Mutations Original Strand: Addition: Substitution:

Genetic Disorders Sickle Cell Anemia: Phenylketonuria (PKU): Albinism: - valine replaces glutamate in amino acid chain of hemoglobin - normal blood cells replaced by sickle shaped cells - abnormal cells block blood vessels, normal cells cannot get through, tissue starved of oxygen, nutrients Phenylketonuria (PKU): - tyrosine converted to phenylpyruvic acid - acid build up causes nervous system damage, mental retardation Albinism: - enzyme that converts tyrosine to melanin defective - subjects will have no skin/hair pigment, appear almost pure white

Chromosomal Mutations Inversion Translocation Duplication Deletion

Chromosomal Disorders Down's Syndrome: - extra chromosome #21 - facial features change (mongolism), mental processing slowed Turner's Syndrome: - absence of second X or Y chromosome - person is single X – short infertile female Kleinfelter's Syndrome: - 3 sex chromosomes – XXY - person is a male that grows tall with long limbs, generally have IQ’s significantly below siblings - sperm count may be reduced or person may be infertile