5' breakpoint in intron 2 (chr19:1,219,187-1,219,238 shown)

Slides:

Advertisements

Similar presentations

One-Gene-One-Enzyme, Pseudogenes & Common Ancestry

Advertisements

Describe the structure of a nucleosome, the basic unit of DNA packaging in eukaryotic cells.

Visualization of genomic data Genome browsers. How many have used a genome browser ? UCSC browser ? Ensembl browser ? Others ? survey.

BME 130 – Genomes Lecture 14 Eukaryotic Genome Anatomy.

BME 130 – Genomes Lecture 7 Genome Annotation I – Gene finding & function predictions.

Aequatus Browser, an open-source web-based tool developed at TGAC to visualise homologous gene structures among differing species or subtypes of a common.

Chapter 6 Gene Prediction: Finding Genes in the Human Genome.

What is comparative genomics? Analyzing & comparing genetic material from different species to study evolution, gene function, and inherited disease Understand.

UCSC Genome Browser 1. The Progress 2 Database and Tool Explosion : 230 databases and tools 1996 : first annual compilation of databases and tools.

File 5 MOUSE sequences used in target gene promoter regions to detect NFATc1 protein binding by ChIP.

.1Sources of DNA and Sequencing Methods.1Sources of DNA and Sequencing Methods 2 Genome Assembly Strategy and Characterization 2 Genome Assembly.

Genetic Code and Interrupted Gene Chapter 4. Genetic Code and Interrupted Gene Aala A. Abulfaraj.

Chen_SupMat 5 – Figure S3. Distribution of private alleles in B

From: Contribution of Copy Number Variation in the Regulation of Complement Activation Locus to Development of Age-Related Macular Degeneration Invest.

Volume 17, Issue 2, Pages (August 2015)

Volume 5, Issue 3, Pages (November 2013)

Example of a common SNP in dogs

Pick a Gene Assignment 4 Requirements

Frequency of Nonallelic Homologous Recombination Is Correlated with Length of Homology: Evidence that Ectopic Synapsis Precedes Ectopic Crossing-Over

Gene Editing Design Demo

Follicular lymphoma with a novel t(14;18) breakpoint involving the immunoglobulin heavy chain switch mu region indicates an origin from germinal center.

RHD gene deletion occurred in the Rhesus box

Highly heterogeneous genomic landscape of uterine leiomyomas by whole exome sequencing and genome-wide arrays Svetlana A. Yatsenko, M.D., Priya Mittal,

by Martin de Boer, Egbert Bakker, Stefaan Van Lierde, and Dirk Roos

Resolving the Breakpoints of the 17q21

Mutations changes in the DNA sequence that can be inherited

Deficiency of the ADP-Forming Succinyl-CoA Synthase Activity Is Associated with Encephalomyopathy and Mitochondrial DNA Depletion Orly Elpeleg, Chaya.

Influence of the Duplication of CFTR Exon 9 and Its Flanking Sequences on Diagnosis of Cystic Fibrosis Mutations Ayman El-Seedy, Tony Dudognon, Frédéric.

Figure S4 Chr1 : CNAG_00378 CNAG_07950* CNAG_07358* CNAG_00383

Genomic Rearrangements Resulting in PLP1 Deletion Occur by Nonhomologous End Joining and Cause Different Dysmyelinating Phenotypes in Males and Females

Molecular Cytogenetic Evidence for a Common Breakpoint in the Largest Inverted Duplications of Chromosome 15 A.E. Wandstrat, J. Leana-Cox, L. Jenkins,

A Novel Gene Causing a Mendelian Audiogenic Mouse Epilepsy

Pathogenicity Islands: Bacterial Evolution in Quantum Leaps

Supplementary Figure 4. Comparisons of MethyLight and gene expression data. PMR values (X-axis) were plotted against log2 gene expression values (Y-axis)

Decoding NF1 Intragenic Copy-Number Variations

Volume 117, Issue 4, Pages (October 1999)

A novel Alu-mediated microdeletion at 11p13 removes WT1 in a patient with cryptorchidism and azoospermia Catarina M Seabra, Sofia Quental, Ana Paula.

The c.1364C>A (p.A455E) Mutation in the CFTR Pseudogene Results in an Incorrectly Assigned Carrier Status by a Commonly Used Screening Platform Kristin.

DNA and the Genome Key Area 6c Chromosome Mutations.

Supplemental Figure 3 A B C T-DNA 1 2 RGLG1 2329bp 3 T-DNA 1 2 RGLG2

Volume 17, Issue 2, Pages (August 2015)

Working in the Post-Genomic C. elegans World

Renata C. Gallagher, Birgit Pils, Mohammed Albalwi, Uta Francke

Mutational analysis of TOX3 in Chinese Han women with polycystic ovary syndrome Yuqian Cui, Shigang Zhao, Han Zhao, Yue Lv, Mengru Yu, Yu Wang, Zi-Jiang.

Examples for intrachromosomal mRNA co‐regulation patches

Reading Frames and ORF’s

Volume 138, Issue 7, Pages (June 2010)

Disruption of Contactin 4 (CNTN4) Results in Developmental Delay and Other Features of 3p Deletion Syndrome Thomas Fernandez, Thomas Morgan, Nicole Davis,

Beth Elliott, Christine Richardson, Maria Jasin Molecular Cell

Karmella A. Haynes, Amy A. Caudy, Lynne Collins, Sarah C.R. Elgin

Volume 9, Issue 4, Pages (November 2014)

DNA and the Genome Key Area 6c Chromosome Mutations.

Ecological Genetics: A Key Gene for Mimicry and Melanism

Complete Haplotype Sequence of the Human Immunoglobulin Heavy-Chain Variable, Diversity, and Joining Genes and Characterization of Allelic and Copy-Number.

Methods applied in addition

.1Sources of DNA and Sequencing Methods 2 Genome Assembly Strategy and Characterization 3 Gene Prediction and Annotation 4 Genome Structure 5 Genome.

DNA Profiling Vocabulary

Computational Genomics of Noncoding RNA Genes

KIT Gene Deletions at the Intron 10−Exon 11 Boundary in GI Stromal Tumors Christopher L. Corless, Laura McGreevey, Ajia Town, Arin Schroeder, Troy Bainbridge,

Activation of MET by Gene Amplification or by Splice Mutations Deleting the Juxtamembrane Domain in Primary Resected Lung Cancers Ryoichi Onozato, MD,

Presented by shehneela sohorwardi: Rollno :117113

Highly heterogeneous genomic landscape of uterine leiomyomas by whole exome sequencing and genome-wide arrays Svetlana A. Yatsenko, M.D., Priya Mittal,

Multiple-exon skipping.

Genomic structure of LTBP-4 around the 3rd 8-Cys repeat.

Identification of TSIX, Encoding an RNA Antisense to Human XIST, Reveals Differences from its Murine Counterpart: Implications for X Inactivation Barbara.

Volume 21, Issue 23, Pages (December 2011)

P-network of 2,616 prokaryote genomes based on chromosomal sequences with rRNA genes removed. P-network of 2,616 prokaryote genomes based on chromosomal.

Break-induced marker excision concept.

Figure Results of duplication analysis and patient 11's chorein analysis and geographical distribution of VPS13A mutations Results of duplication analysis.

Figure Genetic characterization of the novel GYG1 gene mutation (A) GYG1_cDNA sequence and position of primers used. Genetic characterization of the novel.

Presentation transcript:

5' breakpoint in intron 2 (chr19:1,219,187-1,219,238 shown) GGGCAGGGTGGGCCCTGGTCCCGAGGAGGGGCAAGGTGGGTGCAGAGGGTCC A GGCCTTTGCTGGCTTTGCAGCCAGCATCCATCTGGTGGGTGCTGGCTT 3' breakpoint in intron 7 (chr19:1,222,694-1,222,741 shown) Figure S4: Breakpoint sequence of the genomic deletion removing exons 3-7 of the STK11 gene. The sequencing chromatogram produced using the sense primer is shown on top. The breakpoint is depicted using a broken line, with the additional 'A' shown in a rectangle between the two sequences. A short homologous stretch near the breakpoints is highlihted in blue. Chromosome coordinates refer to the Feb 2009 (GHCr37/hg19) human genome assembly.