Molecular Cloning

Definitions Cloning : Sub-cloning: Recombinant Plasmid : Obtaining a piece of DNA from its original source (Genome) and introducing it in a DNA vector Sub-cloning: Transfer of a cloned DNA insert or a part thereof from one vector to another vector Recombinant Plasmid : Vector into which foreign DNA was introduced Recombinant organism Organism with a recombinant vector

Why clone? Separate, identify, manipulate or express a specific DNA fragment 3

Step 1- Separate Two approaches: Fragment/digest genomic DNA Generates a vast number of fragments May be difficult to find fragment of interest PCR Amplification Much less fragments Much easier to find sequence of interest

DNA Replication & Amplification The Polymerase Chain Reaction

Polymerases Primer -OH 3’OH end Polymerase 5’…GTACT 3’…CATGAATGCTGCATTTGCGGGCATTACTC…5’ TACGACGTAAACGCCCGTAATGAG DNA or RNA Template

The Polymerase Chain Reaction-PCR Repetitive replication of a given region of DNA Allows the exponential amplification of a given region of DNA Increases the relative representation of the region of interest Allows the isolation of a given region of DNA 7

PCR-1st Cycle <3’GGAACGGTACCGT5’ Denaturation (95oC) Annealing of primers (Tm) <3’GGAACGGTACCGT5’ 5’CATACCGTGGGGTGCA………..ACGCGTTGCGATGGCA3’ 3’GTATGGCACCCCACGA………..TGCGCAACGCTACCGT5’ 5’CCGTGGGGT3’>

5’CATACCGTGGGGTGCA………..ACGCGTTGCGATGGCA3’ Extension (72oC) <3’GGAACGGTACCGT5’ 5’CATACCGTGGGGTGCA………..ACGCGTTGCGATGGCA3’ 3’GTATGGCACCCCACGA………..TGCGCAACGCTACCGT5’ 3’ 5’ --------------------------------  ----------------------------------  5’CCGTGGGGT3’> 9

PCR-2nd Cycle 3’ 5’ ---------------------------------- -------------------------------------- 5’ 3’ 3’ 5’ ---------------------------------- -------------------------------------- Denaturation -------------------------------  ----------------------------------  Annealing /Extension --------------- --------------

PCR-Subsequent Cycles Only this template is amplified exponentially: 2n times -------------------- ------------------- ------------------------ ------------------------ ------------------------ 32 times total

Review of PCR Cycles PCR Primers: Short single stranded nucleotide sequences complementary to the targets 15-30 nucleotides Used in excess as compared to target to favor primer annealing rather than template self annealing

Review of PCR Cycles Annealing: Extension: Temperature at which primers anneal to complementary target sequences Must be below primer Tm Must be a temperature that allows both primers to anneal Usually between 55-75oC Extension: Carried out at temperature optimum for DNA polymerase Usually 72-75oC for Taq polymerase

Primers Characteristics: Short oligonucleotides complementary to sequences that flank the region of interest Establish the point of initiation of replication Establish the point of termination of replication 14

Primer Design 5’ complementarity 3’…………….ATGGGTATTGGCC…………………..-5’ Template CCATAACCGG-OH3’ 5’CGA 3’ complementarity 3’…………….ATGGGTATTGGCC…………………..-5’ Template TACCCATAACC TA-OH3’ 15

Primer Design 5’ 3’ 3’ 5’ 3’ 3’ Region of interest 3’ Correct orientation Wrong orientation 16

Problem 1- AAAAAA 2- TTTTTT 3- GGGGGG 4- CCCCCC 5’-AAAAAAAAAAAA GGGGGGGGGGGGG-3’ You wish to amplify the sequence represented by the box. Which primer pair represent the correct orientation to accomplish this? 1- AAAAAA 2- TTTTTT 3- GGGGGG 4- CCCCCC 17

Utility of PCR Amplification and isolation of a given region by changing its relative representation Between 100bp and 10Kpb Screening to determine the presence of a sequence of interest Presence or absence of an amplification product Site directed mutagenesis Used to add or remove nucleotides from the original template 18

Cloning Generate compatible ends DNA ligation Restriction Enzyme Appropriate vector Fragment of interest DNA Recombination Intermolecular ligation Recombinant Intramolecular ligation Non-Recombinant Transformation Host Cells Recombinant cell Non-Recombinant cell 1 plasmid/1 cell

Amplification of Recombinant Plasmids Duplication 1 colony= 1 clone with 1 plasmid + 1 insert Bacterial growth

Screening and Identification of Recombinant Plasmid clones Blue-white screening Restriction mapping Hybridization PCR

Screening for Recombinants Alpha complementation “Blue-white" screening β-galactosidase (LacZ) α-peptide (aa 1-92) - Inactive ω-peptide (remainder of LacZ) –Inactive α + ω peptides  active β-galactosidase

Alpha complementation Used in many vectors LacZ promoter MCS - restriction sites for cloning 5' end of lacZ gene - LacZ α-peptide Distinguish E. coli with: Empty vector Vector + insert DNA

Blue – White Screening E.coli → LacZ ω pUC19 → LacZ α Medium with X-gal E.coli - LacZ ω + plasmid with insert NO LacZ α → white colonies E.coli - LacZ ω + plasmid without insert LacZ α → blue colonies