GENETICS UNIT 3

The base of genetics are the molecules of DNA and RNA Both DNA and RNA are very long molecules but their structure is very simple because they are formed by the repetition of the same unit: a nucleotide. DNA and RNA are polymers and nucleotides are their monomers.

Nucleotides

Components of DNA (desoxyribonucleic acid) Sugar: 2-deoxyribose (or just deoxyribose) Phosphate group Nitrogenous base: thymine, adenine, cytosine and guanine

Components of DNA

A sugar, a phosphate group and a nitrogenous base join to form a nucleotide

Nucleotides are linked by a phosphodiester bond

Long chains of nucleotides are formed, all joined by phosphodiester bonds

The structure of DNA is a double helix of two large chains of nucleotides. The two chains are antiparallel.

In the double helix adenine is always joined to thymine and guanine is always joined to cytosine. ALWAYS. Bases are joined by a type of bond that is called “hydrogen bond”. Between thymine and adenine there are two hydrogen bonds and between guanine and cytosine there are three hydrogen bonds.

The order of the bases in DNA gives genetic information In DNA the sugar and the phosphate group are just the “skeleton”: thanks to them the chains of DNA are formed. But it is the sequence of nitrogenous bases that gives the genetic information. We usually refer to one part of DNA by the order of the sequence of the bases, for example: 3´ ATTCAGCATCG 5´

Exercise Write the other strand of DNA in a double helix for the following sequences: a) 3´ATTCGACCGTACGAAAATACGGG5´ b) 5´CGATCCGCAATTCGACCGTTTAG3´

Components of RNA (ribonucleic acid) Sugar: ribose Phosphate group Nitrogenouse base: uracil (NOT thymine), adenine, cytosine and guanine

Components of RNA

Components of RNA A sugar, a phosphate group and a nitrogenous base also join to form a nucleotide. Nucleotides are linked by phosphodiester bonds to form long chains of RNA.

Structure of RNA

In RNA we don´t have a double helix but we can have loops in some parts

In prokaryotic cells (bacterias) the DNA is in the cytoplasm (no separation from other components of the cell)

In eukaryotic cells (humans, animals, plants…) the DNA is in the nucleus, separated from other parts of the cell. We are going to focus on eukaryotic cells.

In humans, plants and animals DNA is joined to proteins forming chromosomes http://learn.genetics.utah.edu/content/chromosomes/intro/

Chromosomes Each species have a specific number of chromosomes. For example, humans have 46 chromomes. Chromosomes can only be seen when the cell is dividing, in a process called mitosis. In the mitosis the chromosomes are condensed and that´s why we can see them.

Celular cycle

Phases in the life of a cell Interphase: the cell is not dividing. During the interphase the DNA duplicates so that when the cell divides in two, each new cell has the same DNA as the original cell. Mitosis: the cell divides in two daughter cells.

Chromosomes at the begining of the mitosis: as the DNA has been duplicated they are formed by two chromatids.

Sexual reproduction and meiosis Meiosis is used to form gametes (sperm and egg cells). In species with sexual reproduction the offspring is produced by the combination of the DNA of two individuals, the father and the mother.

Sexual reproduction and meiosis When a spermatozoon and an egg cell join they form the zygote, which is the initial cell of a new individual. This initial cell will have several mitosis to form the complete new individual. As the zygote is the combination of a spermatozoon and an egg cell, both the spermatozoon and the egg cell have half the amount of the genetic information of the parents, so that the offspring don´t have twice the amount of DNA of their parents.

Sexual reproduction and meiosis During a process called meiosis the genetic information of a cell is reduced to half the amount of it so that a gamete is formed. Masculine gametes are called spermatozooa (plural for spermatozoon) and female gametes are called egg cells.

Sexual reproduction and meiosis A lot of species, humans for example, are diploid (2n), that means that they have pairs of chromosomes, each pair called “homologous chromosomes”, and these are chromosomes that contain the same genes. Humans have 46 chromosomes, or, better said, 23 pairs of chromosomes (2n, n=23).

Female human karyotype

Sexual reproduction and meiosis During the meiosis the pairs of chromosomes (homologous chromosomes) are separated so we obtain cells that have half the genetic information of an individual. Hence, a gamete is formed, which is haploid (n). In the case of humans, both spermatozooa and egg cells have 23 chromosomes.

Sexual reproduction and meiosis (in the example, n=2) https://www.youtube.com/watch?v=nMEyeKQClqI

When a spermatozoon (n) fertilizes an egg (n), a zygote is obtained (2n)

Mendel laws Once upon a time (1860's), in an Austrian monastery, there lived a monk named Gregor Mendel. Monks had a lot of time on their hands and Mendel spent his time crossing pea plants. As he did this over & over & over & over & over again, he noticed some patterns to the inheritance of traits from one set of pea plants to the next. By carefully analyzing his pea plant numbers (he was really good at mathematics), he discovered three laws of inheritance. Mendel's Laws are as follows: 1. The Law of Dominance  2. The Law of Segregation  3. The Law of Independent Assortment

Mendel´s laws In Mendel´s work the words "chromosomes" or "genes" are nowhere to be found.  That is because the role of these things in relation to inheritance & heredity had not been discovered yet. What makes Mendel's contributions so impressive is that he described the basic patterns of inheritance before the mechanism for inheritance (namely genes) was even discovered.

Mendel´s laws There are a few important vocabulary terms we should iron-out before diving into Mendel's Laws. GENOTYPE = the genes present in the DNA of an organism.  We will use a pair of letters (ex: AA or Aa or aa, etc.) to represent genotypes for one particular trait.  There are always two letters in the genotype because (as a result of sexual reproduction) one code for the trait comes from mama organism & the other comes from papa organism, so every offspring gets two codes (two letters). There are three possible GENOTYPES - two big letters (like “AA"), one of each (“Aa"), or two lowercase letters (“aa"). Each possible combo has a term for it.

Mendel´s laws When we have two capital or two lowercase letters in the GENOTYPE (ex: AA or aa) it's calledHOMOZYGOUS ("homo" means "the same").  Sometimes the term "PURE" is used instead of homozygous. When the GENOTYPE is made up of one capital letter and one lowercase letter (ex: Aa) it's calledHETEROZYGOUS ("hetero" means "other").  A heterozygous genotype can also be referred to as HYBRID.

Mendel´s laws PHENOTYPE = how the trait physically shows-up in the organism.   ALLELES = alternative forms of the same gene.  Alleles for a trait are located at corresponding positions on homologous chromosomes.

Mendel´s laws For example: The gene A codifies for brown eyes and the gene a codifies for blue eyes. One individual whose genotype is AA will have brown eyes (phenotype). One individual whose genotype is aa will have blue eyes (phenotype). One individual whose genotype is Aa will have brown eyes (phenotype). This is because A is dominant and a is recessive.

Mendel´s laws http://learn.genetics.utah.edu/content/inheritance/traits/

Mendel´s laws

Mendel´s laws The Law of Dominance  In a cross of parents that are pure for contrasting traits, only one form of the trait will appear in the next generation.  Offspring, which are hybrid for the trait, will have only the dominant trait in the phenotype. The Law of Segregation  During the formation of gametes , the two alleles responsible for a trait separate from each other.  Alleles for a trait are then "recombined" at fertilization, producing the genotype for the traits of the offspring. The Law of Independent Assortment  Alleles for different traits are distributed to sex cells (& offspring) independently of one another.

Mendel’s Laws https://www.youtube.com/watch?v=lppF8Mv4sbo

Mendel´s laws One man with brown hair who is heterozygote (Aa) marries a woman with blonde hair (aa). What percentage of their children will have blonde hair? A) 0% C) 50% B) 25% D) 75% E) 100%

Mendel´s laws One man with albinism (aa) marries a woman with normal colour in her skin who is a homozygote (AA). What percentage of their children will have skin with normal colour? A) 0% C) 50% B) 25% D) 75% E) 100%

Mendel´s laws Two people with familial hypercholesterolemia, who are both heterocygotes (Aa) marry. The gene that causes familial hypercholesterolemia is recessive. Calculate the percentaje of their offspring that will have familial hypercholesterolemia. A) 0% C) 50% B) 25% D) 75% E) 100%

Mendel´s laws The Law of Independent Assortment Alleles for different  traits are distributed to sex cells (& offspring) independently of one another.

Mendel´s laws