What happens when things go wrong?

Slides:

Advertisements

Similar presentations

Mutations. General Definition Long Notes: Any change in DNA sequence is called a mutation. Abbreviated Notes (AN): Mutation (mut) = DNA sequence (seq)

Advertisements

Chapter 12: DNA: The Molecule of Heredity

Protein Synthesis.  Identify the structure and function of DNA, RNA, and proteins.  Recognize diagrams of DNA and RNA, sugars, phosphate groups, nitrogenous.

1.Using the table on Pg. 292, write the amino acid sequence that would be made according to the codons on the mRNA chain. 2.Why do you think this exact.

 Mutation – any change in DNA sequence  Can be caused by errors inside the cell ◦ Errors in  Replication  Transcription  Cell division (mitosis,

MONSTROUS MUTATIONS!!!. What is a mutation? Mutations are changes in DNA! However, these simple changes or mistakes can cause big changes in phenotypes.

Genetic Changes 11.3.

Genetic Mutations Increasing Genetic Diversity May 4, 2010.

What is a mutation? A mutation is any change in genetic material. There are many ways for mutations to occur. Common point mutations are...

Mutations Dr. Evil: I have one simple request. And that is to have sharks with frickin' laser beams attached to their frickin’ heads!... What do we have?

Section 11.3 Genetic Changes.

1 NOTES: MUTATIONS 2 MUTATIONS: MUTATIONS = changes in the DNA sequence that affect genetic information.

Protein Synthesis.  Identify the structure and function of DNA, RNA, and proteins.  Recognize diagrams of DNA and RNA, sugars, phosphate groups, nitrogenous.

MUTATIONS. Mutations Mutation: A change in the DNA sequence (gene), that also changes the protein it codes for. In Sex Cells: can produce new traits or.

Mutations. Mutation effects Reproductive Cells -mutation in DNA sequence of an egg or sperm cell -mutation is passed on to offspring - possible effects.

MUTATIONS. Mutant An organism expressing a mutated gene.

12.4 Mutations Copyright Pearson Prentice Hall.. What Are Mutations? Changes in the nucleotide sequence of DNA (genetic material) May occur in somatic.

Bell Ringer Where does translation occur in the cell? 2.Why do we need RNA to make proteins? 3.How can different codons code for the same amino.

Genetic Changes: Mutations Chapter I. MUTATION  ANY change in an organisms DNA sequence  Causes  Errors in replication  Transcription  Cell.

Wednesday, January 16 th What is a mutation? Reminders: DNA Test Friday.

DNA Mutations Section Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcription translation.

Mutations. What Are Mutations? Changes in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring) May occur in gametes.

Mutation Notes: Chapter 11.

Section 11.3: Genetic Changes

11.3 Mutations.

Mermaid Syndrome Video.

Copyright Pearson Prentice Hall

DNA Mutations & Disorders

Genetic Mutations.

Mutations LN #23 Ms. Garcia California Content Standard Genetics

11.3 Section Objectives – page 296

Mutations Dr. Evil: I have one simple request. And that is to have sharks with frickin' laser beams attached to their frickin’ heads! What do we.

4c. Know how mutations in the DNA sequence of a gene may or may not affect the expression of the gene or the sequence of amino acids in the encoded proteins.

Ch 12-4 Genetic Mutations.

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?

DNA: The Molecule of Heredity

11.3 Section Objectives – page 296

Genetic Mutations.

Presentation transcript:

What happens when things go wrong? Mutations What happens when things go wrong?

Mutations A change in the DNA sequence It’s a mistake made during REPLICATION or TRANSCRIPTION Can be harmful: DISEASES or DEFORMITIES Can be useful: organism is better able to SURVIVE Neutral: organism is UNAFFECTED

Mutations If a mutation occurs in a sperm or EGG cell, that mutation is passed to OFFSPRING If a mutation occurs in a BODY cell, that mutation affects only the organism and is NOT passed on to the offspring

Types of mutations POINT mutations: bases are mismatched (CHANGED) A. Harmful when: a mistake in DNA is carried into mRNA and results in the wrong AMINO ACIDS B. Not harmful when: a mistake in DNA is carried into mRNA but still results in the CORRECT amino acid

Types of mutations FRAMESHIFT Mutations: bases are ADDED or DELETED. A. Are usually HARMFUL because a mistake in DNA is carried into mRNA and results in MANY wrong amino acids NOTE: Extra inserted BASES shifts affect how we read the CODONS (3 bases), which changes the AMINO ACIDS

Types of mutations CHROMOSOMAL Mutations Chromosomes break or are LOST during mitosis or meiosis Broken chromosomes may rejoin INCORRECTLY Almost always lethal (deadly) when it occurs in a ZYGOTE (BABY)

Causes of mutations MUTAGENS: anything that causes a CHANGE in DNA Examples: X rays, UV LIGHT, nuclear radiation, asbestos, CIGARETTE smoke. http://www.youtube.com/watch?v=7jJq6y4pdPA&feature=relmfu

Muscular dystrophy Genetic disease causing weak muscles Symptoms: poor balance, difficulty walking/breathing NORMAL amino acid sequence Start Ser Val Tyr Ala Stop Patient 1 DNA: TAC AGG CAG AUC CGC AUU mRNA codons: Amino Acids: Patient 2 DNA: TAC AGG CAT ATA CGC ATT mRNA codon: Which patient has MD? What type of mutation is MD? At which amino acid did this occur? At which nitrogen base did this occur?