A mutation is a change in an organism’s DNA.

Slides:

Advertisements

Similar presentations

What do you think of when you hear the word “mutation”?

Advertisements

KEY CONCEPT Mutations are changes in DNA that may or may not affect observable traits/characteristics.

Defined: any change in an organism’s DNA Where: Single genes or entire chromosomes – Some gene mutations change phenotype (physical characteristics)

Gene Mutations. Target #17- I can describe a gene mutation Gene mutation: a permanent heritable change in the sequence of bases in DNA – Effect can cause.

DNA replication—when? Where? Why? What else does a cell do?

SC.912.L.16.4 Explain how mutations in the DNA sequence may or may not result in phenotypic change. Explain how mutations in gametes may result in.

Chapter 12-Inheritance Patterns and Human Genetics

Defined: a change in an organism’s DNA Where: DNA or Chromosomes When: During replication, Synapses, or Crossing-Over Mutations can affect a single.

A mutation is a change in an organism’s DNA.

Mutations are changes in DNA that may or may not affect phenotype.

8.7 – Mutations. Key Concept  Mutations are changes in DNA that may or may not affect phenotype. mutated base.

Mutations. A Mutation is a change in an organism’s DNA  It can occur naturally whenever a base is incorrectly copied, especially during DNA Replication.

MUTATIONS Honors Biology Section 11.6 & Biology Section 8.7 Revised 2011.

8.7 Mutations TEKS 6E The student is expected to: 6E identify and illustrate changes in DNA and evaluate the significance of these changes.

8.7 Mutations A mutation is a change in an organism’s DNA. This may or may not affect phenotype.

KEY CONCEPT 8.5 Translation converts an mRNA message into a polypeptide, or protein.

8.7 Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype.

Reality Science Fiction! Just silly.. 1. Some mutations affect a single gene, while others affect an entire chromosome. 2. A mutation is a change in an.

8.7 Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype.  May occur in somatic cells (aren‘t passed to offspring)

Central Dogma of Molecular Biology Genetic information flows in one direction – from DNA to RNA to proteins.

MUTATIONS Mutations Defined: a change in an organism’s DNA. Many kinds of mutations can occur, especially during replication. 2 Types: 1)Gene Mutations:

8.7 Mutations A mutation is a change in an organism’s DNA. May occur during replication. May affect a single gene, or an entire chromosome May or may not.

8.2 KEY CONCEPT DNA structure is the same in all organisms.

8.7 Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype.

Griffith finds a ‘transforming principle.’

May occur in somatic cells (aren‘t passed to offspring)

Mutations 6/26/2018 SB2d.

Mutations Bio Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations.

A mutation is a change in an organism’s DNA.

Do Now: Write the questions and answer them on page ___.

Mutations Bio Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations.

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations -changes in a single base pair in DNA=changes in the nucleotide.

A mutation is a change in an organism’s DNA.

UNIT 5 Protein Synthesis.

A mutation is a change in an organism’s DNA.

A mutation is a change in an organism’s DNA.

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations Alternative alleles (traits) of many genes result from changes.

A mutation is a change in an organism’s DNA.

Some mutations affect a single gene, while others affect an entire chromosome.

mutation = change in an organism’s DNA.

A ____________ is a change in an organism’s DNA.

Sexual reproduction creates unique combinations of genes.

Section 1: Mutation and Genetic Change

A mutation is a change in an organism’s DNA.

SB2. The learner will analyze how biological traits are passed on to successive generations. d. Describe the relationships between changes in DNA and potential.

A mutation is a change in an organism’s DNA.

A mutation is a change in an organism’s DNA.

Mutations Chapter 8.7.

SC.912.L.16.4 Explain how mutations in the DNA sequence may or may not result in phenotypic change. Explain how mutations in gametes may result in.

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?

Draw a conclusion from this graph for both the red and blue line

A mutation is a change in an organism’s DNA.

A mutation is a change in an organism’s DNA.

Mutations Chapter 8.7

Objective: Explain the main types of mutations

Copyright Pearson Prentice Hall

A mutation is a change in an organism’s DNA.

A mutation is a change in an organism’s DNA.

A mutation is a change in an organism’s DNA

Presentation transcript:

KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype.

A mutation is a change in an organism’s DNA. Some mutations affect a single gene, while others affect an entire chromosome. A mutation is a change in an organism’s DNA. Many kinds of mutations can occur, especially during replication. A point mutation substitutes one nucleotide for another. mutated base

Many kinds of mutations can occur, especially during replication. A frameshift mutation inserts or deletes a nucleotide in the DNA sequence. https://www.youtube.com/watch?v=eDbK0cxKKsk (7 min)

Genotype: The DNA sequence that determines a specific characteristic Genotype: The DNA sequence that determines a specific characteristic. Genotypes specify the type of genes people have. Phenotype: The observable physical or biochemical characteristic of an organism. Some examples include eye color and hair patterns. Genotype: SOX3 Phenotype: Hypertrichosis

Mutations may or may not affect phenotype. Chromosomal mutations tend to have a big effect. Some gene mutations change phenotype. A mutation may cause a premature stop codon. A mutation may change protein shape or the active site. A mutation may change gene regulation. blockage no blockage

Now you try! DNA: TAC AGA TCA GGG GTG ACT mRNA: AUG UCU AGU CCC CAC UGA A.A.: Met Ser Ser Pro His Stop DNA: TAC AGG TCA GGT GTG ACT mRNA: AUG UCC AGU CCA CAC UGA A.A.: Met Ser Ser Pro His Stop Do these mutations affect phenotype? Remember: Amino acid sequence determines protein function! If the A.A. sequence is wrong, the protein may not work (and may even do damage).

Some gene mutations do not affect phenotype. A mutation may be silent (see last slide). A mutation may occur in a noncoding region. A mutation may not affect protein folding or the active site.

Mutations in body cells (somatic) do not affect offspring. Ninja Turtles versus X-Men Mutations in germ cells, or sex cells, can be harmful or beneficial to offspring. Ninja Turtles versus X-Men Natural selection often removes mutant alleles from a population when they are less adaptive.

Mutations can be caused by several factors. Replication errors can cause mutations. Mutagens, such as UV ray and chemicals, can cause mutations. Carcinogens can cause cancer Sunlight & Radiation Charbroiled Meat Cigarettes Some cancer drugs use mutagenic properties to kill cancer cells.

Cancer What are two reasons human cells divide? Growth and Repair Cells are told to grow, stop growing, or to “shut down” (apoptosis) through chemical messages Ex: Human Growth Hormone (HGH) – Tells cells to divide Cells can stop responding to these signals if their DNA mutates Cells that keep dividing and ignore apoptosis signals are considered to be cancer Cancer: Uncontrolled cell division Video: https://youtu.be/7_5MnsdQeQs?t=30s Prostate is a gland by the bladder; Only in men Video starts at “Your body and everything it is made up of cells”