Hereditary Colorectal Cancer: From Genetic Testing to Prevention

Slides:



Advertisements
Similar presentations
CT COLONOGRAPHY. CRC TRENDS  Incidence decreased by 7%  Mortality decreased by 20%  Five year survival rates increased by 12%
Advertisements

Hereditary GI Cancer Syndromes: Keys to identify high risk patients
Colon and Rectal Cancer Update
Supported by grants from: National Human Genome Research Institute (ELSI) HG/AG (The REVEAL Study); National Institute on Aging AG (The MIRAGE.
1 An Update on Evolving Colorectal Screening Issues May 19, 2011 This first part today will be presented by: Stanley H. Weiss, MD, FACP, FACE  Professor,
Introduction to Cancer Genetics
Gene 210 Cancer Genomics April 29, Key events in investigating the cancer genome M R Stratton Science 2011;331:
Lynch Syndrome and Colorectal Cancer Steven G. Proshan, M.D. Annapolis Colon and Rectal Surgeons Anne Arundel Medical Center November 8,
Update on Screening of Gastrointestinal Diseases Niraj Jani, M.D. Greater Baltimore Medical Center 1/30/15.
Screening for Colorectal Cancer Cancer Symposium: Measuring the Benefits of Screening and Treatment October 2007.
A few thoughts on cancer and cancer family syndromes Pamela McGrann, MD. Department of Medical Genetics.
COLORECTAL BLEEDING: a multidisciplinary approach Torino, 31 marzo-1 aprile 2006 GENETIC EVALUATION Schena M, Angelini F, Bertetto O. Department of Medical.
Lecture 22 Cancer Genetics II: Inherited Susceptibility to Cancer Stephen B. Gruber, MD, PhD November 19, 2002.
Mechanisms and Epidemiology of Colon Cancer
Genetics and Ovarian Cancer Jeanne M. Schilder, M.D. Associate Professor, Gynecologic Oncology Indiana University Medical Center September 19, 2012.
Genetics and Primary Care
Hereditary Colorectal Cancer: An Overview Felice Schnoll-Sussman,MD Jay Monahan Center for Gastrointestinal Health New York Hospital/ Weill Cornell Medical.
About these slides SPEC – Short Presentation in Emerging Concepts
Familial Colorectal Cancers Francis M. Giardiello, M.D. The Johns Hopkins University.
Kalyani Maganti, M.D. ASCO Chromosomes, DNA, and Genes Cell Nucleus Chromosomes Gene Protein.
Morning Report May 20, 2009 Bridger Clarke  Born in Lawrence, Massachusetts, on 4 January  Dropped out of high school at the age of fourteen.
Introduction to Cancer Genetics and Genomics Apostolos Psychogios, MD, FACMG Associate Professor of Pediatrics LeeAnne Brown Chair of Clinical Excellence.
Gene 210 Cancer Genomics May 5, Key events in investigating the cancer genome M R Stratton Science 2011;331:
DR Jameel Tariq Miro.  Lifetime incidence 5%  90% of cases occur after age 50  One-third of patients with colorectal cancer die from the disease 
Cancer Genetics for Primary Care Sara Levene Registered Genetic Counsellor.
Otis W. Brawley, M.D. Chief Medical and Scientific Officer Executive Vice President American Cancer Society Professor of Hematology, Medical Oncology,

 2 nd overall leading cause of cancer death in the United States › 3 rd in each sex  Approximately 6% of individuals in the US will develop a cancer.
Update on Colon Cancer Screening and Prevention
Breast Screening. NHS Breast Screening Programme Introduced in 1988 Invites women from age group for screening every 3 yrs. Age extension roll-out.
Genetics & Colorectal Cancer
Familial Risk And Pathological Outcomes Of Colorectal Cancer In An Asymptomatic General Population Cohort By: Michelle Medina.
The Cancer Pedigree BRCA What?. Outline Introduction: Understanding the weight of genetics in Ovarian Breast Cancer BRCA 1 and BRCA 2 Genes – Function.
Genetics of Colorectal Cancer
A Colonscope is used to remove or biopsy polyps  Night Prep.
High risk population in GI field how we can find them? Ahmad Shavakhi MD Associate professor of gastroenterology.
COLORECTAL CANCER SCREENING in December of 2002 Jeffrey W. Frank, MD.
Cancer Incidence and Mortality in Massachusetts, Bureau of Health Statistics, Research and Evaluation Massachusetts Department of Public Health.
CURRENT NATIONAL PREVENTIVE HEALTH CARE GUIDELINES Juanita Halls, M.D. Professor of Medicine General Internal Medicine University of Wisconsin - UW Health.
INCIDENCE AND SURVIVAL TRENDS OF COLORECTAL CANCER FROM 2002 TO 2011 BE Ansa; E Alema-Mensah; MD Claridy; JQ Sheats; B Fontenot, and SA Smith Georgia Regents.
Prevention and Health Promotion Administration May Overview of Colorectal Cancer Maryland Department of Health & Mental Hygiene Prevention and Health.
Familial Risk and Surveillance of Colon and Rectum Malcolm Dunlop Academic Coloproctology & Colon Cancer Genetics Group University of Edinburgh & Western.
CANCER CONTROL NHPA’s. What is it? Cancer is a term to describe a diverse group of diseases in which some of the cells in body become defective. The following.
What are Microsatellites? D2S123 TAGGCCACACACACACACACA Unique Primer Mono, di, tri, tetra nucleotide repeats HNPCC - Expansion/contraction of nl repeats.
Cancer Prevention Eyad Alsaeed, MD,FRCPC Consultant Radiation Oncology PSHOC KFMC.
Robert E. Schoen, MD MPH Associate Professor of Medicine and Epidemiology Division of Gastroenterology University of Pittsburgh Organizing Colorectal Cancer.
Gynecological Malignancies. Gynecologic malignancies account for 15% of all cancers in women. Gynecologic malignancies account for 15% of all cancers.
Screening for Colorectal Cancer (CRC) Nov, 2007 A Aljebreen, FRCPC Division of Gastroenterology KKUH, Riyadh.
Familial Risk And Pathological Outcomes Of Colorectal Cancer In An Asymptomatic General Population Cohort By: Michelle Medina And Nanjika Small.
Identifying and Managing Hereditary Cancer Syndromes © 2005 Myriad Genetic Laboratories, Inc. Monica Trout, MS Genetic Counselor / Regional Medical Specialist.
Do you have 3 or more affected relatives? (2 or less)
Robert E. Schoen, MD MPH Associate Professor of Medicine and Epidemiology Division of Gastroenterology University of Pittsburgh Hereditary Colorectal Cancer:
How Do We Individualize Guidelines in an Era of Personalized Medicine? Douglas K. Owens, MD, MS VA Palo Alto Health Care System Stanford University, Stanford.
Hereditary Cancer Predisposition: Updates in Genetic Testing
What does the data tell us? Colorectal CANCER IN NEVADA
Colorectal Cancer Screening Guidelines
The Burden of Colorectal Cancer in Arkansas
Kyle Salsbery Genetic Counselor
A consultand is an individual under evaluation for predicting his or her own future risk or the risk of his or her offspring. The arrow identifies the.
EPIDEMIOLOGY.
What are Microsatellites?
Hereditary Gastrointestinal Cancers
Cancer screening PROF .MAZIN AL-HAWAZ.
Cancer Epidemiology Kara P. Wiseman, MPH, Phd
Nat. Rev. Clin. Oncol. doi: /nrclinonc
Lynch syndrome (LS) Hereditary Non-polyposis Colorectal Cancer (HNPCC)
Baseline characteristics of older women (NHS I), younger women (NHS II), and men (HPFS) with a history of hypertension according to thiazide use Eric N.
Antoni Castells, Sergi Castellví–Bel, Francesc Balaguer 
Colorectal Cancer Update
Family History to Promote Individual Health
Presentation transcript:

Hereditary Colorectal Cancer: From Genetic Testing to Prevention Robert E. Schoen, MD MPH Associate Professor of Medicine and Epidemiology Division of Gastroenterology University of Pittsburgh

Colorectal Cancer - Epidemiology 2nd leading cause of CA mortality in U.S. > 130,000 new cases/yr > 48,000 deaths/yr

Estimated Cancer Deaths in U.S. - 1999 Men Women Lung - 31% Lung - 25% Prostate - 13% Breast - 16% Colorectal - 10% Colorectal - 11%

Lifetime Risk of CRC (%) Male + Female LR Dx LR Death All Races 5.88 2.57 Whites 5.99 2.63 Blacks 4.42 2.14 SEER, 1992 - 4

Etiologic Concepts in CRC

Colorectal Cancer 1%

Click for larger picture

Intermediate Endpoint Environment Alteration in Large Bowel Epithelium Cancer Host

Polymorphisms and CRC Risk Low penetrance susceptibility alleles- Meta Analysis OR APC I1307K 1.6 (1.2 - 2.1) HRAS1-VNTR 2.5 (1.5 - 4.1) MTHFR (val/val) 0.8 (0.6 - 0.9) P53, NAT1, NAT2, GSTM1, GSTT1, GSTP1 exclude >1.7 fold increase Houlston, Gastro 2001;121:282

TCE: Colonoscopy or DCBE + FS Consensus Guidelines > = 50  Options:  Annual FOBT  FS q 5 yrs  FOBT + FS  DCBE q 5-10 yr  Colon q 10 yr  + TCE: Colonoscopy or DCBE + FS Gastro. 1997:112;594

Familial CRC

Family Hx - Prospective Study NHS & HPFS (1) 87,000 women; 32,000 men 315 and 148 cases CRC RR = Incidence CRC with fm hx* CRC Incidence CRC with NO fm hx CRC 1o relative = mother, father, sibs Fuchs et al; NEJM 1994;331:1669-74

Family Hx - Prospective Study NHS & HPFS (2) Family Hx CRC reported by 10% of sample RR CRC with Fm Hx = 1.7* * adjusted for diet, ASA, physical activity, cigs, screening endoscopy Fuchs et al; NEJM 1994;331:1669-74

Family Hx - Prospective Study NHS & HPFS (3) Conclusions: •  Risk with 2 or more 1o relatives •  Risk with family member  55

AHCPR Guidelines Family Hx • CRC in 1 or 2 (?) FDR • Adenomas in FD relative  60 Same Options as Avg Risk, but Start at age 40 Gastro 1997:112;594

Germline Mutations

Gastro 2001;121:195

HNPCC - Clinical Characteristics • Autosomal dominant, highly penetrant • CRC <age 45,  synchro/proximal • Polyps - larger, more aggressive; cancers better prognosis • Endometrial, ovarian, other CA’s

HNPCC Recognition • Early onset cancers • Multiple cancers in successive generations • Association with other cancers - endometrial

HNPCC - “Amsterdam Criteria” • Three or more relatives with CRC, one of whom is 1o relative of other two • CRC in at lest 2 generations • One or more cases before age 50

Amsterdam Criteria II 3 Relatives with HNPCC associated CA: CRC, Endometrial, Small Bowel Ureter, Renal Pelvis • 1 should be 1o Relative of other 2 • 2 successive generations (at least) • 1 diagnosed before age 50 FAP excluded Verify Tumors

CRC@40 CRC@56 Endomet @48 CRC@45 CRC@68 CRC@48