Mutations Announcement Quiz over Mutations on Monday! Test Wednesday!!! All genetics lessons

Any _________in DNA is a ________. I. Mutations Any _________in DNA is a ________. Most mistakes/changes happen during… _______________(during mitosis OR meiosis) _______________ _______________ (nondisjunction) These occur _________or can be caused by the _____________, called mutagenic factors, like… ______________(UV, X-Ray, Gamma Ray) _______________(Tobacco use, pollution)

II. Mutations in Reproductive (Sex) Cells VS. Body cells -Mutations in ___________(a.k.a. gametes) can be _______________to a person’s children, but might not affect the parent -Mutations in _____________cannot be _____________to your children, however, they can cause cancer or other problems

II. Mutations in sex cells -X-men and X-women would be a result of mutations in sex cells. These people inherited mutated (changed) DNA from their parents:

III. Cancer as a result of mutations in body cells:

III. Cancer as a result of mutations in body cells: ___________________environmental/chemical factors that cause cancer Tongue cancer and lung cancer are often caused by changes in body cells as a result of smoking, so don’t smoke!!!

Radiation- Think Spider-Man!!!

Gene mutations There are two types of gene mutations: _________________

Example: DNA  RNA  Amino Acid IV. Point mutation Also called a _________________ a _______________of ______________in a DNA sequence. can cause an _______________to change, which then _____________________being made. Example: DNA  RNA  Amino Acid TAC  AUG Met TTC  AAG Lys -Only one letter was SUBSTITUTED (the A to a T) and the entire amino acid changed (from methionine to lysine).

IV. Point mutation Normal Point mutation mRNA Protein Stop Replace G with A Point mutation mRNA Protein Stop

Point mutations in our lives! Sickle cell anemia is a blood disease caused by a ________________point mutation. A single nucleotide is changed from “A” to “T” which causes the amino acid to change from glutamic acid to valine: Amino acids: Thr – Pro – Glu – Glu Normal: ACT CCT GAG GAG Sickle cell: ACT CCT GTG GAG Amino acids: Thr – Pro – Val – Glu

V. Frameshift mutation A _______________mutation is when one nucleotide is ____________________from the DNA or mRNA strand. Ex: DNA TACTTCAAACCGCGTAACATT mRNA Protein

Difference between a substitution mutation and a frameshift mutation.

Questions: Is this a substitution mutation or a frameshift mutation? -It’s a ____________________mutation because G was __________________with a T!

Questions: THE DOG BIT THE CAT THE DOG BIT THE CAR Substitution or frameshift? ____________________!

Questions THE DOG BIT THE CAT THE DOB ITT HEC AT Substitution or frameshift? ________________! The mutated sentence makes _________(non-sense) and thus the protein will not be made

ATCGCGTATTCG ATCGGGTATTCG What mutation is this?? ATCGCGTATTCG ATCGGGTATTCG

What mutation happened here?? ATCGCGTATTCG ATCGCTATTCG

What mutation happened here?? ATCGCGTATTCG ATCGCGTTATTCG

Chromosome Mutations There are two types of ______________mutations _____________of chromosome mutated _____________chromosome missing/ added

Partial chromosome mutations 4 major types _______________

Partial Chromosome Mutations _________________ Part of the chromosome ___________during __________________ The illustration on the right depicts a deletion of the tip of the p arm of chromosome 5

deletion of the tip chromosome 5. causes a genetic condition called cri du chat syndrome(cry of the cat). Approximately 1 infant in 50,000 Common findings in children with cri du chat include a cat-like meowing cry, mental retardation, hypotonia in infancy, microcephaly, and characteristic facial features  Age 6 And Age 16

Partial Chromosome Mutations ______________ ___________of chromosome ___________, changes ___________and reattaches

Partial Chromosome Mutations ______________ A section of chromosome is ____________

Duplication of Chromosome mutation Charcot–Marie–Tooth disease  disorder of the peripheral nervous system characterised by progressive loss of muscle tissue and touch sensation across various parts of the body. Currently incurable; affects approximately 1 in 2,500 people

Partial Chromosome Mutations _________________ Piece of broken chromosome __________with a ____________chromosome

Translocation Chromosome mutation  leukemia (acute myelogenous leukemia and chronic myelogenous leukemia) Infertility: One of the would-be parents carries a balanced translocation, where the parent is asymptomatic but conceived fetuses are not viable.

Whole chromosome Mutations ______________ Chromosomes fail to ________correctly during ___________ Can result in ________ or _________________chromosomes Examples: Down Syndrome, Turner syndrome

Turner Syndrome Loss of an X chromosome  Complications include: short stature, swelling, broad chest, low hairline, low-set ears, and webbed necks, nonworking ovaries,  congenital heart disease, hypothyroidism , diabetes Down Syndrome Additional 21 chromosome Complications include:  physical growth delays, characteristic facial features, and mild to moderate intellectual disability. Max IQ of 8-9 year old.