Transcription and Translation Video Notes Mingle Transcription and Translation Video Notes -share main points -make sure all 3 of you share (start tallershorter student)

Announcements -Monday MC Quiz on S phase, Mitosis, Meiosis -Study Guide Available Friday Afternoon SHMOOP REVIEW Go to https://schools.shmoop.com/login/centinela-valley-UHSD/ Select your school Sign in or create a Student Account on the next page Use the student magic word: CVUHSDROCKS

Assemble DNA (white), RNA (blue), and 2 Amino Acids (pink) DNA RNA Amino Acids

Make observations on each molecule Similarities Differences

DNA vs. RNA DNA RNA deoxyribose sugar nitrogen bases double stranded G, C, A, T T : A C : G double stranded RNA ribose sugar nitrogen bases G, C, A, U U : A C : G single stranded

Amino acids

Structures of a protein

Protein Synthesis Making Proteins 2009-2010

DNA  Proteins  Cells  Bodies DNA has the information to build proteins genes proteins cells DNA gets all the glory, Proteins do all the work bodies

How do proteins do all the work proteins run living organisms enzymes control all chemical reactions in living organisms structure all living organisms are built out of proteins

Cell organization DNA DNA is in the nucleus genes = instructions for making proteins want to keep it there = protected “locked in the vault” cytoplasm nucleus

From nucleus to cytoplasm transcription DNA mRNA protein translation trait nucleus cytoplasm

Transcription Making mRNA from DNA DNA strand is the template (pattern) match bases U : A G : C Enzyme RNA polymerase

Matching bases of DNA & RNA Double stranded DNA unzips T G G T A C A G C T A G T C A T C G T A C C G T

Matching bases of DNA & RNA Double stranded DNA unzips with RNA POLYMERASE T G G T A C A G C T A G T C A T C G T A C C G T

Matching bases of DNA & RNA Match RNA bases to DNA bases on one of the DNA strands after TATA box C U G A G U G U C U G C A A C U A A G C RNA polymerase U A G A C C T G G T A C A G C T A G T C A T C G T A C C G T

Matching bases of DNA & RNA U instead of T is matched to A TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA ribosome U C A G

Before leaving the nucleus… Removal of introns Poly A-tail—3’ end GTP Cap—5’ end

cytoplasm protein nucleus ribosome U C A G trait

How does mRNA code for proteins mRNA leaves nucleus mRNA goes to ribosomes in cytoplasm Proteins built from instructions on mRNA How? mRNA U C A G aa

How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA ribosome AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein aa How can you code for 20 amino acids with only 4 DNA bases (A,U,G,C)?

mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA codon ribosome AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein Codon = block of 3 mRNA bases

The mRNA code For ALL life! Code has duplicates Start codon strongest support for a common origin for all life Code has duplicates several codons for each amino acid mutation insurance! Strong evidence for a single origin in evolutionary theory. Start codon AUG methionine Stop codons UGA, UAA, UAG

Open book to pg 299

How are the codons matched to amino acids? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA codon UAC Met GCA Arg tRNA CAU Val anti-codon amino acid Anti-codon = block of 3 tRNA bases

mRNA to protein = Translation The working instructions  mRNA The reader  ribosome The transporter  transfer RNA (tRNA) ribosome mRNA U C A G aa tRNA G U aa tRNA U A C aa tRNA G A C tRNA aa A G U

DNA mRNA protein trait From gene to protein tRNA transcription aa transcription translation DNA mRNA protein ribosome U C A G tRNA aa trait nucleus cytoplasm

Gizmo https://www.explorelearning.com/index.cfm?method=cResource.dspView&ResourceID=442

From gene to protein protein transcription translation

To Do: With your partner Assemble DNA (1-4) Show steps of transcription. You can use scratch paper for additional enzymes or info. Show 3 post-transcriptional modifications Show steps of translation. Use pg 299 in book for code Practice before filming. Both students need to speak during each part of p.synthesis Email me: morris-ohearnv@cvuhsd.org

Peer Evaluation on Mitosis Argument Share with 5 people—3 at your table and 2 of your choice Use of academic language—5 or more terms Evidence statements need data Justification should have a well reasoned argument to support claim