RFLIPS analysis or Who’s your Daddy? Dna Finger Printing RFLIPS analysis or Who’s your Daddy?

Dna naturally has some minor differences Dna naturally has some minor differences. These are called polymorphisms These are often found in uncoded regions of DNA. (junk DNA) Jared might have the uncoded base pairs ATTCATTCATTC Verena’s might be ATTCATTCATTCATTCATTC hers is a little longer but it doesn’t matter because it’s not coded. Everyone’s DNA is unique. We can “Tag” some of these differences by adding radioactive complimentary strands and let them pair up. We can see them better. Polymorphisms

Palindromes A lad named E. Mandala A man, a plan, a canal: Panama. A nut for a jar of tuna Go hang a salami I’m a lasagna hog Aibohphobia Able was I ere I saw elba Dammit I’m mad My gym Won’t lover’s revolt now Tod erases a red dot Seven elves Senile felines Palindromes

Restriction enzymes are naturally found in bacteria Restriction enzymes are naturally found in bacteria. Their job is to cut up any viral DNA that attacks it into little pieces. Defence against intruders. Each restriction enzyme has it’s own “palindrome” that it recognizes and cuts. EcoR1 uses GAATTC this reads the same forwards and back. CTTAAG It makes a staggered cut between the GA in the sugar phosphate backbone. Every time it reads this sequence Restriction enzymes

There are many kinds of restriction enzymes some leave “sticky end” with unpaired bases hanging out to bond Some leave blunt ends

DNA is Negatively charged because of the phosphates in the backbone. Because everyone's DNA is unique i.e. a different length. When we cut then with the same restriction enzyme everyone's fragments will be a different length. So we can separate them using electrophoresis. The smaller pieces go faster than the bigger pieces. If the bands match then you did it. Fragment lengths

RFLPS Analysis Restriction fragment length polymorphisms Take the DNA from the crime scene. Cut it with a restriction enzyme. Take DNA from all the suspects. Cut each of them with the same restriction enzyme. Make an electrophoresis gel of agarose. Perform electrophoresis. 1 well for the crime scene. 1 well for each suspect. Stain the gel so you can see the DNA. Destain the gel so that only the DNA is stained (Not the agarose) Compare the bands on the light tray if they match you did it!!! Sometimes they repeat the process with a different restriction enzyme just to be sure. RFLPS Analysis

DNA Fingerprinting