Bioinformatics in Drug Design

Slides:

Advertisements

Similar presentations

The Drug Discovery Process

Advertisements

Knowing When to Give Up Sensible Evaluation in Virtual Screening for Drug Discovery Gwyn Skone Stephen Cameron and Irina Voiculescu.

Future CAMD Workloads and their Implications for Computer System Design IEEE 6th Annual Workshop on Workload Characterization.

Dr. Basavaraj K. Nanjwade M.Pharm., Ph.D

19 March 2009KLE College of Pharmacy, Belgaum 1 Drug Design: Discovery, Development and Delivery Dr. Basavaraj K. Nanjwade M.Pharm., Ph.D Associate Professor.

S TRUCTURAL B IOINFORMATICS. A subset of Bioinformatics concerned with the of biological structures - proteins, DNA, RNA, ligands etc. It is the first.

OMICS Group Contact us at: OMICS Group International through its Open Access Initiative is committed to make genuine and.

20/03/2008 Dept. of Pharmaceutics 1 APPLICATIONS OF BIOINFORMATICS IN DRUG DISCOVERY AND PROCESS RESEARCH Dr. Basavaraj K. Nanjwade M.Pharm., Ph.D Associate.

+ Drug Development and Review Process. + Objectives Learn the processes involved in drug discovery and development Define the phases involved in FDA drug.

Doug Brutlag 2011 Genomics, Bioinformatics & Medicine Drug Development

Bioinformatics Ayesha M. Khan Spring Phylogenetic software PHYLIP l 2.

Important Points in Drug Design based on Bioinformatics Tools History of Drug/Vaccine development –Plants or Natural Product Plant and Natural products.

GGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTAC CCTGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGG

Cédric Notredame (30/08/2015) Chemoinformatics And Bioinformatics Cédric Notredame Molecular Biology Bioinformatics Chemoinformatics Chemistry.

Asia’s Largest Global Software & Services Company Genomes to Drugs: A Bioinformatics Perspective Sharmila Mande Bioinformatics Division Advanced Technology.

Rational Drug Design Soma Mandal, Mee'nal Moudgil, Sanat K. Mandal.

Chapter 13. The Impact of Genomics on Antimicrobial Drug Discovery and Toxicology CBBL - Young-sik Sohn-

Introduction to Chemoinformatics Irene Kouskoumvekaki Associate Professor December 12th, 2012 Biological Sequence Analysis course.

CS 790 – Bioinformatics Introduction and overview.

TOPICS IN (NANO) BIOTECHNOLOGY

Concepts and Applications of Pharmacokinetics

Harbin Institute of Technology Computer Science and Bioinformatics Wang Yadong Second US-China Computer Science Leadership Summit.

Anne Hersey ChEMBL Group, EMBL-EBI ChEMBL – A Database of Bioactive Drug-like Small Molecules.

Drug Discovery Primary objective－

Virtual Screening C371 Fall INTRODUCTION Virtual screening – Computational or in silico analog of biological screening –Score, rank, and/or filter.

Bioinformatics MEDC601 Lecture by Brad Windle Ph# Office: Massey Cancer Center, Goodwin Labs Room 319 Web site for lecture:

Proteomics Session 1 Introduction. Some basic concepts in biology and biochemistry.

Jobs, Careers, Internships, Senior Projects and Research Computer Application Development K-12 education Industrial Training Bioinformatics Validation.

ECCR Overview/MLSCN. NIH Roadmap Series of initiatives designed to pursue major opportunities in biomedical research and gaps in current knowledge that.

1 Pharmacokinetics: Introduction Dr Mohammad Issa.

Introduction to Chemoinformatics and Drug Discovery Irene Kouskoumvekaki Associate Professor February 15 th, 2013.

Introduction to Pharmacology Yacoub Irshaid MD, PhD, ABCP Department of Pharmacology.

1 Biopharmaceutics Dr Mohammad Issa Saleh. 2 Biopharmaceutics Biopharmaceutics is the science that examines this interrelationship of the physicochemical.

Shows tendency for mergers. These big companies may be shrinking – much research is now outsourced to low cost countries like Latvia, India, China and.

Drug Discovery & Development

신기술 접목에 의한 신약개발의 발전전망과 전략 LGCI 생명과학 기술원. Confidential LGCI Life Science R&D 새 시대 – Post Genomic Era Genome count ‘The genomes of various species including.

Molecular Modeling in Drug Discovery: an Overview

독성학 박 대 훈 한약재산업학과

Structural Bioinformatics in Drug Discovery Melissa Passino.

Page 1 Computer-aided Drug Design —Profacgen. Page 2 The most fundamental goal in the drug design process is to determine whether a given compound will.

Drug UCIBIO Maria João Ramos

Chapter 8, part B Microbial Genetics.

Chapter 8, part B Microbial Genetics.

Homology Modeling and Docking to Potential Novel Inhibitor for

Drug Discovery &Development

Introduction to Pharmacology

Figure 1. Biotechnology sector’s knowledge base

Antibody Drug Conjugates Services Antibody-drug conjugates Antibody-drug conjugates (ADCs) are a very important class of highly potent drugs designed as.

APPLICATIONS OF BIOINFORMATICS IN DRUG DISCOVERY

Biotechnology Objectives: At the end of this lecture we will be able to identify and describe the uses of biotechnology in society.

Important Points in Drug Design based on Bioinformatics Tools

Discovery and Development of Medicines

Drug Affinity Responsive Target Stability (DARTS).

Molecular Docking Profacgen. The interactions between proteins and other molecules play important roles in various biological processes, including gene.

Structural Bioinformatics in Drug Discovery

Biopharmaceutics Dr Mohammad Issa Saleh.

Virtual Screening.

“Structure Based Drug Design for Antidiabetics”

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

CTD Module 4: Non-Clinical Studies SPC Relevant Scientific information

Nancy Baker SILS Bioinformatics Seminar January 21, 2004

Insight into the Pharmaceutical Industry

Important Points in Drug Design based on Bioinformatics Tools

Drug Design and Drug Discovery

Introduction to Bioinformatic

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

Prokaryotic Genomes Chapter 18.

Chapter 8, part B Microbial Genetics.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

Presentation transcript:

Bioinformatics in Drug Design 11/7/2018 Bioinformatics in Drug Design

Topics Drug Discovery Pipeline Databases Data processing/analysis Network modeling/analysis Rational/Structure-based design Clinical Trials/Registration

Drug Discovery Pipeline Target Discovery Lead Finding/Discovery Lead Optimization Exploratory Development Clinical Trials/Registration

Target Discovery Find out where to act Methods: activate/repress receptor or enzyme? different points in network? Methods: Metabolic/Regulatory Network analysis Comparative Genomics Homology Modeling Microarray/CGA

Lead Finding/Discovery Find ‘some’ molecule that does ‘something’ with your target: bind activate repress Methods: HTS Virtual screening Combichem Cheminformatics

Lead Optimization Find better molecule that does exactly what you want, and nothing else specific for target possible side-effects Methods: Targeted screening Rational/Structure-based design QSAR ADME(T) (Absorption, Disposition, Metabolism, Excretion, Toxicology)

Exploratory Development Find out what your molecule does in ‘real life’ uptake, breakdown, toxicity positive and negative effects Methods: Animal models Gene markers Expression profiles ‘Translational modeling’ from animal to human (?) Pharmacokinetic modeling/ADME(T)

Drug Discovery Pipeline target discovery lead finding lead optimization exploratory development clinical phase(s) ~14 years ~ $ 800 million

Bioinformatics in Pipeline target discovery lead finding lead optimization exploratory development clinical phase(s) network analysis comparative genomics microarray microarray CGA CGA homology modeling homology modeling SNPs/haplotypes SNPs/haplotypes virtual screening molecular modeling rational/structure based design ADME(T)/pharmacokinetics modeling animal models