Genetics Big Picture Review Framework 3

DNA Double helix – Shape of DNA; two strands of nucleotides DEOXYRIBONUCLEIC ACID A type of NUCLEIC ACID One of the four classes of biological molecules Function: Contains GENES- all the codes for our traits Double helix – Shape of DNA; two strands of nucleotides Like a ladder that is twisted

Building Blocks of DNA - NUCLEOTIDES Nucleotide is made of three parts: sugar, nitrogen base and phosphate groups. Backbone (alternating on the sides of the DNA ladder) Sugar (deoxyribose) Phosphate

Base Pairing Rules Bases pair with each other like a puzzle Adenine (A) --- Thymine (T) Guanine (G) --- Cytosine (C) Held together by HYDROGEN BONDS The order of the sequence determines the trait. Ex: ACCTTGGTC - blue eyes ACCTGGGTC – brown eyes

Replication Transcription Translation The central dogma describes how information is sent through a cell to make proteins. Replication Transcription Translation replication transcription translation RNA is a link between DNA and proteins.

DNA Replication –copying of DNA during S-phase of cell cycle In order to make new cells (cell division) our DNA needs to make copies of itself!

Structure of RNA How is that different from DNA?? Single strand of nucleotides Sugar is called ribose Ribonucleic Acid 4 Nitrogen Bases Adenine Guanine Cytosine Uracil ****** How is that different from DNA??

TWO types of RNA Messenger RNA (mRNA) – created during transcription. Carries message from nucleus to ribosome. Transfer RNA (tRNA) - transfers a specific active amino acid to a growing protein chain on a ribosome during protein synthesis.

DNA to RNA - Transcription DNA cannot leave the nucleus, so it must copy it’s message to messenger RNA (mRNA). THIS IS CALLED TRANSCRIPTION mRNA then goes from nucleus to the ribosomes in cytoplasm. mRNA nucleotide triplicates are known as codons Only 3 nucleotide “letters” long Ex: AUG, CCG, UAC Remember RNA has uracil (U) instead of thymine (T)!

Protein Synthesis (Translation) mRNA on ribosome is “translated” into protein. Process uses tRNA and genetic code to create proteins. Each codon (3 nitrogen bases) codes for one amino acid Ex – AUGCCGACUCCUGAA CCG: proline ACU: threonine

Bio Molecule: Proteins Function – Structure, support, speed up chemical reactions.

Genetic Code 20 amino acids 64 triplet (codon) combinations *** When AUG is at the beginning of a protein it is a START codon

Let’s Translate Protein: Start – Pro – Ser – Gln – Leu – Arg - Stop mRNA: AUG/CCA/UCG/CAG/UUG/CGG/UGA Protein: Start – Pro – Ser – Gln – Leu – Arg - Stop DNA: TACCGGATATCCGCTCTACCGTCGATT mRNA: AUG/GCC/UAU/AGG/CGA/GAU/GGC/AGC/UAA Protein: Start – Ala – Tyr – Arg – Arg –Asp – Gly – Ser - Stop

Mendel noticed that genes have “FORMS” He named them: ALLELES Example of alleles: Gene for hair color Blonde allele Brown allele Gene for eye color Blue allele Brown Allele Variations of Genes

Dominant and Recessive Alleles Some alleles are expressed over other alleles. These alleles are known as DOMINANT alleles DOMINANT alleles are marked by using a capital letter (ex: A C T F) DOMINANT alleles are NOT always the most popular!! Polydactyl is a dominant trait!!

Recessive Alleles RECESSIVE alleles are not expressed if there is a dominant allele present! We use lower case letters for recessive traits (ex: a b d f t) Examples of recessive alleles: Blonde hair Normal vision Colorblindness Attached earlobes

What color hair do you have?? Inheritance Because you receive ONE set of chromosomes from your mother and ONE set from your father…. YOU MUST HAVE 2 ALLELES FOR EVERY GENE! 1 from mom and 1 from dad! Example: Mom gives you an allele for brown hair (B) and Dad gives you an allele for blonde hair (b) your genes for hair color….. Bb What color hair do you have??

GENETIC POSSIBILITIES Keeping in mind that you have 2 alleles for every gene, the following combinations can result: HOMOZYGOUS DOMINANT Both copies are dominant (DD) Also known as a “purebred” dominant HOMOZYGOUS RECESSIVE Both copies are recessive (dd) ONLY time you will actually SEE a recessive trait! HETEROZYGOUS Having one copy that is dominant and one that is recessive (Dd) Appears as a DOMINANT trait!

Describing Genetic Inheritance There are two different ways of describing someone’s genetics! GENOTYPE What the two alleles, or GENES, are that control a specific characteristic Ex: Aa, bb, CC, Ff, tt PHENOTYPE What the organism physically looks like Ex: Tall, blue, red, freckles, blonde

Mendel noticed that genes have “VERSIONS” He named them: ALLELES Example of alleles: Gene for hair color Blonde allele Brown allele Gene for eye color Blue allele Brown Allele Variations of Genes

Dominant and Recessive Alleles Some alleles are expressed over other alleles. These alleles are known as DOMINANT alleles DOMINANT alleles are marked by using a capital letter (ex: A C T F) DOMINANT alleles are NOT always the most popular!! Polydactyl is a dominant trait!!

Recessive Alleles RECESSIVE alleles are not expressed if it’s heterozygous We use lower case letters for recessive traits (ex: a b d f t) Examples of recessive alleles: Blonde hair Normal vision Colorblindness Attached earlobes

What color hair do you have?? Inheritance Because you receive ONE set of chromosomes from your mother and ONE set from your father…. YOU MUST HAVE 2 ALLELES FOR EVERY GENE! 1 from mom and 1 from dad! Example: Mom gives you an allele for brown hair (B) and Dad gives you an allele for blonde hair (b) your genes for hair color….. Bb What color hair do you have??

GENETIC POSSIBILITIES Keeping in mind that you have 2 alleles for every gene, the following combinations can result: HOMOZYGOUS In the genotype, both alleles are the same. (dominant or recessive). Ex: AA bb CC HETEROZYGOUS In the genotype, the two alleles are different. (one dominate & one recessive) Ex: Aa Bb Cc

Describing Genetic Inheritance There are two different ways of describing someone’s genetics! GENOTYPE Describes the actual GENES that are inherited Ex: Aa, bb, CC, Ff, tt PHENOTYPE Describes the PHYSICAL look of the trait Ex: Tall, blue, red, freckles, blonde

Other Types of Inheritance INCOMPLETE DOMINANCE The dominant trait is not capable of fully masking the recessive gene Heterozygous genotypes end up with a “blended” phenotype Ex: RR – red flowers rr – white flowers Rr – pink flowers

Codominance/Multiple Alleles Some genes have more than two (2) dominant alleles When BOTH dominant alleles are inherited, both dominant alleles are expressed! Ex: Roan cows Red is dominant (R) White is dominant (W) RW is a red and white cow (roan)

ABO Blood Types- Multiple Allele Human Blood Types are a classic example of codominance and multiple alleles!! Human Blood Types Type A blood (dominant) Type B blood (dominant) Type AB blood (CODOMINANT) Type O blood (recessive)

Certain traits are found ONLY on the X chromosome! Sex – Linked Traits Certain traits are found ONLY on the X chromosome! These traits are usually RECESSIVE…so happen more often in MALES Because males only have ONE X chromosome…if they inherit an “infected” X they will automatically have the disorder A girl will ONLY get the disorder if she inherits TWO infected X’s

Polygenic Some traits can’t be described as “either/or”! They involve a variety of choices because they involve multiple genes coding for them!

Mendel’s Laws After his work with pea plants, Mendel developed two important genetic laws….. Law of Independent Assortment When chromosomes line up in pairs during MEIOSIS they do it RANDOMLY Causes VARIATION

Law of Segregation When chromosomes split during MEIOSIS II, genes do not “follow” each other You can be a “mix” of DOMINANT and RECESSIVE traits