Chapter 4 Section 1 Pages 86-89 What Does DNA Look Like? Chapter 4 Section 1 Pages 86-89 Liz LaRosa www.middleschoolscience.com 2011

Deoxyribonucleic Acid What is it? A molecule. Where is it found? In the nucleus of every living cell. What is its function? Determines inherited characteristics

Shape: Double Helix (Twisted Ladder) Components to the sides of the ladder: Sugar and a phosphate molecule Pattern – The sugar and phosphate alternates. Component to the rungs of the ladder: Nitrogen Bases Adenine always pairs with Thymine Guanine always pairs with Cytosine

Discovering the structure of DNA Erwin Chargaff – (1905-2002) Columbia University, NY Investigated the composition of DNA His findings by 1950 strongly suggested the base-pairings of A-T & G-C Met with Watson and Crick in 1952 and shared his findings “Chargaff’s rule” A = T & C = G

Discovering the structure of DNA Rosalind Franklin (1920-1958) King’s College, London Made significant advances in x- ray diffraction techniques with DNA Her images suggested that DNA had a spiral shape One of her DNA images

Discovering the structure of DNA James Watson (1928) and Francis Crick (1916-2004) Worked together at Cavendish Laboratory in Cambridge to determine the structure of DNA Used work from Franklin, Wilkins (worked with Franklin), and Chargaff to determine the double helix shape Watson, Crick, and Wilkins were awarded the Nobel Prize Rosalind Franklin passed away (1958) before the Nobel Prize was awarded in 1962

DNA – What does my code look like? Computer Code: 10010100111010001100101001110010111100101001001001001011100101000101010010010100101010010010100101001010100101001010010101010101001010100101010111111100 DNA Code: ATTCGGGGCCTTAAGACATTAATTTCCCAAGAAGAGATAAACTAGAGAGACCCTTTAAAACACACAGAGATAGACAGAAAAACAATAGACAGATACAGATAGACATAAAAAATTTTTTGGGAAA…millions and millions of bases… “Gattaca” is a science fiction movie starring Uma Thurman, Ethan Hawke, and Jude Law

G A T T A C C T A A T G Groups of 3 = Codon Practice DNA Base Pairs “Gattaca” is a science fiction movie starring Uma Thurman, Ethan Hawke, and Jude Law Groups of 3 = Codon

Making Copies of DNA -Replication DNA helix unzips (unwinds) Each side is now a pattern.

Matching nucleotides pair up with the exposed pattern (exact pattern is copied).

Result = 2 identical strands of DNA ½ of the old strand and ½ is the new strand Original DNA strands