MECCANISMI DI RESISTENZA AGLI INIBITORI DELLE TIROSINCHINASI Giuseppe Saglio Università di Torino

Sensitivity to Imatinib CML progression years 1 2 3 4 5 Ph+ Ph1 N The mechanisms of Imatinib resistance are in part similar to those associated with disease progression Sensitivity to Imatinib

Resistance: More frequent in Advanced Disease Phases 100 88 75 66 51 1° resistance 2° relapse at 2 years 50 24 25 13 5 4 4 Early CP Late CP AP (600 mg) My. BC (600 mg) Hochhaus and La Rosée Leukemia. 2004

Similar mechanisms with different incidence Two types of resistance to Imatinib with respect to time of onset: Front-line Acquired after initial response Front-line Acquired Similar mechanisms with different incidence

Pathophysiology of imatinib resistance BCR-ABL proliferation Other defects Imatinib BCR-ABL proliferation Imatinib not able to suppress the BCR-ABL TK This clear-cut scheme is an oversimplification! Clonal evolution (with or without ACA) Point mutations BCR-ABL amplification Insufficient IMA in cells

(MAY AMPLIFY RESIDUAL tk ACTIVITY) Other mechanisms (MAY AMPLIFY RESIDUAL tk ACTIVITY) Residual BCR-ABL TK activity ( MUTATIONS, ETC.....)

The role of IM transporters Cellular disposition of IM results from a delicate equilibrium between drug uptake and efflux: Ph+ cell IM hOCT-1 BCR-ABL White et al. 2007; Crossman et al. 2005; Wang et al. 2008 IM IM Cellular disposition of imatinib results from a delicate equilibrium between drug uptake and efflux. We now know that imatinib transport into target cells is mediated by hOCT1, while transport out of cells is mediated by ABCB1, also known as MDR-1 or P-glycoprotein. Any perturbation in transport may determine suboptimal intracellular concentrations of imatinib, hence insufficient inhibition. Perturbations may derive from alterations in the expression levels, that is, overexpression of ABCB1 or reduced expression of hOCT1, or from alterations in activity, due either to acquired mutations or to inherited polymorphisms. IM Altered expression? Point mutations? Polymorphisms? ABCB1 (MDR-1) IM

hOCT1 Expression And Response Correlation between hOCT1 expression and MCyR Correlation between hOCT1 expression and MMR Primohamed et al. Blood 2004 Crossman et al., Blood 2005 White et al. Blood 2007

Many BCR-ABL mutations in 4 critical regions: - different sensitivity to imatinib inhibition - different transforming activity - ability to confer different clinical prognosis (?) P-loop Gate keepers Catalytic domain Activation loop M244V D276G V289A M343T E355G/D H396R/P S417Y L248V T277A M351T/V L387M/F G250E E255K/V F311L/I F317L F359V F382L E459K Q252R/H F486S V379I Y253F/H T315I A380T reveiwed in O’Hare T et al., Blood 2007

resistant pts harbouring Abl KD mutations Mutations rarely account for primary resistance to IM, but are frequent in acquired resistance Loss of response Upfront resistance* Acquired resistance** 30% 60% resistant pts harbouring Abl KD mutations * failure to achieve a HR by 3 months, failure to achieve a CCgR by 12 months ** loss of CCgR, loss of HR or progression Soverini S. et al., Clin Cancer Res 2006 Soverini S. et al., Clin Cancer Res 2006

resistant pts harbouring Abl KD mutations Mutations do not account for all IM-resistant cases (especially in CP) CP – IM frontline CP – after IFN failure AP/BC 20% 35% 80% resistant pts harbouring Abl KD mutations Soverini S. et al., Clin Cancer Res 2006

High insensitivity to imatinib Lower insensitivity to imatinib BCR-ABL Imatinib IC50 (nM) Biochemical Cellular WT 300 260-500 M244V 380 2000 P-loop L248V n.a. 1500 G250E 3900 Q252H 1200-2800 Y253F >5000 3475 Y253H >10000 E255K 2800 4400-8400 E255V D276G F311L 775 480 T315I F317L 900 810-1500 Catalytic domain M351T 820 930 E355G 400 F359V 4700 1200 Activation loop V379I 800 1630 A380T 340 2450 L387M 1100 L387F H396P 340-800 850-4200 H396R 1950 1750 F486S 1230 High IC50 High insensitivity to imatinib Low IC50 Lower insensitivity to imatinib Hochhaus et al., Corbin et al., Shah et al., Von Bubnoff et al., O’Hare et al.

ATP pocket mutations in ABL tyrosin-kinase domain can preexist to Imatinib treatment Mutation T1052C (M351T) abolishing a restriction enzyme cut Start of therapy October 2001 Relapse April 2002 Blood, 2002

Bcr-Abl induces reactive oxygen species that cause self-mutagenesis Koptyra et al., Blood 2006

How Frequent Is BCR-ABL-independent Resistance? 30-40% Hochhaus et al. Leukemia 2003

Nucleus Y177 Y1294 GRB2 GAB2 SOS RAS SHC ERK MYC CRKL P amplifications GDP SHC GTP ERK MYC STAT-5 STAT-1 CRKL P amplifications mutations Even small changes in the signal transduction pathway downstream of BCR-ABL may amplify a residual TK activity JUN Nucleus

SHAOGUANG LI, Leukemia & Lymphoma 2008

Src kinases are involved in CML progression

In imatinib-resistant patients whith no detectable BCR-ABL kinase mutation: Lyn kinase is found constantly activated. Lyn activation is BCR-ABL independent, Lyn is complexed with the Gab2 and c-Cbl adapter/scaffold proteins Wu J et al. Blood 2008; Wu J et al. J. Natl Cancer Inst 2008

Expression levels of EphA3 expressed as 2-DDct Imatinib resistant cases F. Messa et al., ASH 2007

Institute "Seràgnoli" - Bologna CML Normal Institute "Seràgnoli" - Bologna

Role of negative regulators Protein tyrosine phosphatase 1B (PTP1B) is a negative regulator of BCR-ABL mediated transformation PTP1B activates Src by dephosphorylating Tyr527

The equilibrium between the activities of TKs and Phosphatases is critical, but it is complex and not yet well understood Kinases (more than one) Phosphatases Fabrizio Pane & co, ASH 2008

Best Responses to Nilotinib by 12 Months in Imatinib Resistant Patients by Baseline Mutation Status IC50 (nM)   Incidence at baseline MCyR CCyR MMR % n/N (%) No Mutation 45 50/87 (60) 35/87 (40) 21/76 (28) Any Mutations 52 51/100 (51) 33/103 (32) 18/91 (20) Others** 15 19/30 (63) 15/30 (50) 5/20 (25) IC50 ≤150 nM   23 26/44 (59) 18/44 (41) 12/40 (30) IC50 >150 nM Y253H 700 4 1/8 (13) 0/8 (0) 0/7 (0) E255K/V 548/791 3/7 (43) 1/7 (14) F359C/V 258/161 6 2/11 (18) 0/11 (0) 0/10 (0) 14% Saglio G et al., ASCO 2008 abs # 7060

P-loop residues 248-256 are highlighted Dasatinib 70 mg BID in chronic-phase CML Response by individual baseline BCR-ABL mutation Cellular IC50 (nM) Dasatinib Imatinib n M244V 1.3 2000 17 L248V 1500 9 G250E/V 1.8 1350–3900 23 Y253F/H/K 1.3–10 >10000 14 E255K/V 5.6–13 4400–8400 10 D276G 1500 3 Complete CyR Partial CyR Complete HR No response T315I >1000 >10000 3 F317L 7.4 1050 4 M351T 1.1 930 15 E355G 400 6 F359C/I/V 2.2 1200 8 L387M 2.0 1000 2 H396P/R 0.6–1.13 850–4200 17 Other 30 P-loop residues 248-256 are highlighted

Switch to a 2nd TKI 95 pts relapsed on IM and switched to a 2nd TKI had evidence of ABL KD mutations did not have evidence of ABL KD mutations 18/51 (35%) 14/51 (27%) 19/51 (38%) 7/44 (16%) 5/44 (11%) 32/44 (73%) achieved and maintained* response did not respond because of the mutation they had relapsed with newly acquired mutations relapsed with newly acquired mutations relapsed with no evidence of mutations achieved and maintained* response p=0.02 median time to relapse: 8 months (1-22) *median observation time, 18 months (range, 6-32) Soverini et al., ASH 2007

Spectrum and frequency of BCR-ABL KD mutations recovered after TKI therapy Jabbour et al., ASH 2006

Additional (cyto)genetic All types of imatinib resistance are due to genomic instability, but the activated pathways seem different Genomic instability Additional (cyto)genetic defects Mutagenesis Clonal evolution Clones with BCR-ABL mutations

Cells PH+ harboring the oncogenic BCR-ABL show an increase in ROS and DSB which leads to an increase in DSBs and inaccurate repair, introducing further genetic changes. Nowicki et Al Blood 2006

BCR-ABL-induced AID expression in CML LyBP and ALL Ph+ ALL …. Feldhahn et al., 2007 JEM ….. AID expression induces T315I and E255K mutations in CML LyBP Previous studies demonstrated that AID expression is tightly regulated by the transcription factor PAX5 and is overexpressed in Ph+ leukemias Muschen et al. AACR 2008

AID (Activation induced cytidine deaminase) consensus sequences ex1-3 ex8 Additional nucleotides intron 3 intron 7 catccagggatctcagaaattattagtac cccggc catccagggatctcagaaatt cccgcag catccagggatctcagaaattattagtaca cccccccggag catccagggatctcagaa cccctgaaa catccagggatctcagaaattattagtacatcc g ccccag cccc gggtct gaa gcgg catccagggatctcagaaa cttgaggg catccagggatctcagaaattattagtacatcccacagtgaa catcaagtctagtgtaactgtttcttcttcaaggtgatttgcattttat acatcaagtctagtgtaactgtttcttcttcaaggtgatttgcattttat tcttcttcaaggtgatttgcattttat aaacatcaagtctagtgtaactgtttcttcttcaaggtgatttgcattttat atcaagtctagtgtaactgtttcttcttcaaggtgatttgcattttat tgcattttattcctgaatgcctgagggttc gttgctgtggaaacatcaagtctagtgtaactgtttcttcttcaaggtgatttgcattttat In particular, the deletions were restricted to highly localized sequences in introns 3 and 7.Recombination Signal sequences (RSSs) recognized by the RAG enzymes during V(D)J recombination were located immediately internal to the deletion breakpoints, and a variable number of additional nucleotides (patient specific) were present at the conjunction. AID CONSENSUS MOTIFS IKZF1 deletions arise from aberrant RAG/AID mediated recombination

There is a complete concordance between the extent of this deletion and the expression of the dominant-negative isoform Ik6. deletion ex1-3 ex4 ex5 ex6 ex7 ex8 Ik6 Wild-type IKZF1 deletion M RT-PCR analysis WB Cbl (120 kDa) Ctr Cytoplasmatic localization Expression of non-DNA-binding Ikaros isoforms is due to IKZF1 genomic abnormalities, and not aberrant post-transcriptional splicing. The extent of this deletion correlated with the expression of the dominant-negative isoform Ik6 with cytoplasmatic localization and oncogenic activity. This finding enforces the concept that the expression of non-DNA-binding Ikaros isoforms is due to IKZF1 genomic abnormalities, and not aberrant post-transcriptional splicing induced by BCR–ABL1. F. Messa, Turin 2008

Resistence = plastic phenomenon Imatinib Clone without mutations Clone with Mutation Can BMT represent the best therapeutic option after two consecutive failures with TKIs? LBH or ON012380 Clone with T315I Dasatinib or nilotinib

ICSG on CML Thanks to.... WP 4 on CML …for support and collaboration.