Selection of Oligonucleotide Probes for Protein Coding Sequences

Slides:

Advertisements

Similar presentations

Recombinant DNA Technology

Advertisements

Fa07CSE 182 CSE182-L4: Database filtering. Fa07CSE 182 Summary (through lecture 3) A2 is online We considered the basics of sequence alignment –Opt score.

Homology Based Analysis of the Human/Mouse lncRNome

Nucleic Acid Hybridization Nucleic acid hybridization is a fundamental tool in molecular genetics which takes advantage of the ability of individual single-stranded.

Bioinformatics Workshop.  We started by discussing what bioinformatics is and how it is used  We learned that DNA is the information about an organism.

Probe design for microarrays using OligoWiz Rasmus Wernersson, Assistant Professor Center for Biological Sequence Analysis Technical University of Denmark.

. Class 4: Fast Sequence Alignment. Alignment in Real Life u One of the major uses of alignments is to find sequences in a “database” u Such collections.

Expect value Expect value (E-value) Expected number of hits, of equivalent or better score, found by random chance in a database of the size.

Sequence similarity (II). Schedule Mar 23midterm assignedalignment Mar 30midterm dueprot struct/drugs April 6teams assignedprot struct/drugs April 13RNA.

Probe design for microarrays using OligoWiz. Sample Preparation Hybridization Array design Probe design Question Experimental Design Buy Chip/Array Statistical.

Selection of Optimal DNA Oligos for Gene Expression Arrays Reporter : Wei-Ting Liu Date : Nov

Predicting RNA Structure and Function. Nobel prize 1989Nobel prize 2009 Ribozyme Ribosome RNA has many biological functions The function of the RNA molecule.

Sequence Comparison Intragenic - self to self. -find internal repeating units. Intergenic -compare two different sequences. Dotplot - visual alignment.

Basics of hybridization. What is hybridization? n Complementary base pairing of two single strands of nucleic acid  double strand product u DNA/DNA u.

Genomics and bioinformatics summary 1. Gene finding: computer searches, cDNAs, ESTs, 2.Microarrays 3.Use BLAST to find homologous sequences 4.Multiple.

1 Automated Searching of Polynucleotide Sequences Michael P. Woodward Supervisory Patent Examiner - Art Unit

1 Lesson 3 Aligning sequences and searching databases.

Sequence Analysis. DNA and Protein sequences are biological information that are well suited for computer analysis Fundamental Axiom: homologous sequences.

©2003/04 Alessandro Bogliolo Primer design. ©2003/04 Alessandro Bogliolo Outline 1.Polymerase Chain Reaction 2.Primer design.

Interdisciplinary Center for Biotechnology Research

PCR Primer Design Guidelines

PCR optimization. Primers – design must be good but influenced by template sequence Quality of template DNA/impurities Components of PCR may need to be.

Nucleic Acid Secondarily Structure AND Primer Selection Bioinformatics

Page 1 Mouse Genome CGH Microarray 44A. Page 2 Mouse Genome CGH Microarray Kit 44A Designed for CGH, Validated with samples of known aberrations Designed.

MicroRNA Targets Prediction and Analysis. Small RNAs play important roles The Nobel Prize in Physiology or Medicine for 2006 Andrew Z. Fire and Craig.

Library screening Heterologous and homologous gene probes Differential screening Expression library screening.

Dave Palmer Primer Design Dave Palmer

Probe Design Using Exact Repeat Count August 8th, 2007 Aaron Arvey.

From Structure to Function. Given a protein structure can we predict the function of a protein when we do not have a known homolog in the database ?

An Empirical Study of Choosing Efficient Discriminative Seeds for Oligonucleotide Design Won-Hyong Chung and Seong-Bae Park Dept. of Computer Engineering.

LECTURES 3/4. CONSTRUCTING and SCREENING cDNA LIBRARIES to ISOLATE NEW GENES ORIGINAL ARTICLES: CLONING BY COMPLEMENTATION: Lew, D, Dulic, V, and Reed.

Design of oligonucleotides for microarrays and perspectives for design of multi-transcriptome arrays Henrik Bjorn Nielsen, Rasmus Wernersson and Steen.

Basic terms:  Similarity - measurable quantity. Similarity- applied to proteins using concept of conservative substitutions Similarity- applied to proteins.

A Tutorial of Sequence Matching in Oracle Haifeng Ji* and Gang Qian** * Oklahoma City Community College ** University of Central Oklahoma.

Summarization of Oligonucleotide Expression Arrays BIOS Winter 2010.

CHAPTER SIX Nucleic acid hybridization: principles and applications 생물정보학협동과정 강민호.

Lecture 6. Functional Genomics: DNA microarrays and re-sequencing individual genomes by hybridization.

Pairwise Local Alignment and Database Search Csc 487/687 Computing for Bioinformatics.

A Bioinformatics Tool for Analyzing G-quadruplexes in the mRNA Untranslated Regions ザカレザッパァ Zachary Zappala.

Large-scale Prediction of Yeast Gene Function Introduction to Bio-Informatics Winter Roi Adadi Naama Kraus

Doug Raiford Phage class: introduction to sequence databases.

Blast 2.0 Details The Filter Option: –process of hiding regions of (nucleic acid or amino acid) sequence having characteristics.

Probe Selection Problems in Gene Sequences. (C) 2003, SNU Biointelligence Lab, DNA Microarrays cDNA: PCR from.

Motif Search and RNA Structure Prediction Lesson 9.

From: Duggan et.al. Nature Genetics 21:10-14, 1999 Microarray-Based Assays (The Basics) Each feature or “spot” represents a specific expressed gene (mRNA).

What is BLAST? Basic BLAST search What is BLAST?

Introduction to Oligonucleotide Microarray Technology

Shruthi Prabhakara, Raj Acharya Department of Computer Science and Engineering, Pennsylvania State University We propose a two-pass semi-supervised fuzzy.

Basics of hybridization. What is hybridization? n Complementary base pairing of two single strands of nucleic acid  double strand product u DNA/DNA u.

D. Darban, Ph.D Department of Microbiology School of Medicine Alborz University of Medical Sciences 1 Probe and Primer Design.

9/6/07BCB 444/544 F07 ISU Dobbs - Lab 3 - BLAST1 BCB 444/544 Lab 3 BLAST Scoring Matrices & Alignment Statistics Sept6.

What is BLAST? Basic BLAST search What is BLAST?

Results for all features Results for the reduced set of features

From: Optimized design and assessment of whole genome tiling arrays

Evaluating classifiers for disease gene discovery

Lecture 4: Probe & primer design

Position specific effect of SNP on signal ratio from long oligonucleotide CGH microarrays; most single probe aberrations represent genuine genomic variants.

Nucleic Acid Interactions Practicalities

DNA Library Design for Molecular Computation

Introduction to Bioinformatics II

Introduction to Bioinformatics II

mRNA Degradation and Translation Control

Fitness measures for DNA Computing

Information Theoretical Probe Selection for Hybridisation Experiments

Automated Searching of Polynucleotide Sequences

Bioinformatics, Vol.17 Suppl.1 (ISMB 2001) Weekly Lab. Seminar

Matthew W Jones-Rhoades, David P Bartel Molecular Cell

Summarized by Sun Kim SNU Biointelligence Lab.

Presentation transcript:

Selection of Oligonucleotide Probes for Protein Coding Sequences Xiaowei Wang and Brian Seed Bioinformatics, 19(7), 2003

(C) 2003, SNU Biointelligence Lab, http://bi.snu.ac.kr/ Introduction Most oligo collections Contain poorly validated sequences Biased toward untranslated regions(3’ UTRs) Presumption that oligo dT will be used to prime the RNA populations Sequence divergence is typically greater in the regions A strategy for picking oligos for microarrays that focus on design universe consisting of protein coding regions (C) 2003, SNU Biointelligence Lab, http://bi.snu.ac.kr/

(C) 2003, SNU Biointelligence Lab, http://bi.snu.ac.kr/ Process Probe candidates creation from target sequences Filtering by oligo picking criteria Representative probe selection ACGCGTCGCGAGGCCTAGGCC… Probe candidates (C) 2003, SNU Biointelligence Lab, http://bi.snu.ac.kr/

(1) Location in the sequence Random priming Result in the creation of probes that have significant representation of non-coding RNAs Oligo dT priming Result in probes that are enriched for mRNAs, but that will not necessarily encompass the entire coding region Use random primed labeling because we interested in understanding the contributions of different coding region isoforms. (C) 2003, SNU Biointelligence Lab, http://bi.snu.ac.kr/

(C) 2003, SNU Biointelligence Lab, http://bi.snu.ac.kr/ (2) Tm uniformity Melting temperatures should fall in a narrow range Evaluate all sequences in the data set Determine the median Tm for oligos by Probe candidate is discarded if its Tm is not within 5℃ of the median Tm (C) 2003, SNU Biointelligence Lab, http://bi.snu.ac.kr/

(3) Probe accessibility Consider secondary structure The likelihood of secondary structure is greatest in regions of significant self-complementarity, for example in the stems of stem-loop structures Tested for homology to the complementary strand of their cognate sequences using BLAST (C) 2003, SNU Biointelligence Lab, http://bi.snu.ac.kr/

(4) Reduced cross-hybridization Single mismatch can be expected to destabilize the hybridization complex. Rejection of contiguous sequence identity Quick search using hash table data structure (C) 2003, SNU Biointelligence Lab, http://bi.snu.ac.kr/

(C) 2003, SNU Biointelligence Lab, http://bi.snu.ac.kr/

(5) Evasion of non-coding RNA and low complexity regions Sequence regions similar to rRNA or snRNA are avoided during the probe selection process by using both contiguous base match screening and BLAST Low-complexity regions are likely to contribute to cross-hybridization (identified by DUST program(Hancock and Armstrong, 1994)) (C) 2003, SNU Biointelligence Lab, http://bi.snu.ac.kr/

(C) 2003, SNU Biointelligence Lab, http://bi.snu.ac.kr/ Results 60,000 mouse sequences in NCBI protein database 70mer probes Tm: 79℃±5℃ (C) 2003, SNU Biointelligence Lab, http://bi.snu.ac.kr/

Impact of oligo probe length (C) 2003, SNU Biointelligence Lab, http://bi.snu.ac.kr/

Impact of BLAST score filter (C) 2003, SNU Biointelligence Lab, http://bi.snu.ac.kr/

Impact of probe self-annealing filter (C) 2003, SNU Biointelligence Lab, http://bi.snu.ac.kr/

Impact of combining all screening filters (C) 2003, SNU Biointelligence Lab, http://bi.snu.ac.kr/