Intracellular Trafficking

Slides:



Advertisements
Similar presentations
Protein sorting and the Golgi apparatus
Advertisements

Chapter 13 Intracellular Vesicular Traffic 張學偉 助理教授.
Intracellular Transport1 Chapter 15 You should review functions of different organelles We already discussed evolution; review Focus will be on: 1) mechanisms.
Protein Sorting & Transport Paths of Protein Trafficking Nuclear Protein Transport Mitochondrial & Chloroplast Transport Experimental Systems Overview.
Chapter 12 Intracellular Compartments and Protein Sorting.
Chapter 26 Protein Sorting. Chapter Objectives Understand the pathways of cotranslational processing of proteins – ER, Golgi, Plasma membrane, Lysosomes.
Javad Jamshidi Fasa University of Medical Sciences Proteins Into membranes and Organelles and Vesicular Traffic Moving.
Intracellular Compartments ER, Golgi, Endsomes, Lysosomes and Peroxisomes.
FIGURE The three modes of intracellular protein transport.
Transport, con't.. The Na/K ATPase Consequences of Na/K ATPase Two ion gradients –Used as energy source –Electrical signaling Charge difference across.
Protein Sorting ISAT 351, Spring 2004 College of Integrated Science and Technology James Madison University.
Copyright © 2005 Pearson Prentice Hall, Inc. Intracellular Compartments and Transport Membrane Enclosed Organelles Protein Sorting Vesicular Transport.
Most proteins in the ER are glycosylated Proteins in cytosol are rarely glycosylated original precursor oligosaccharide added to most proteins in the ER.
Lecture 16 Vesicle transport and targeting in the secretory pathway
Cytoplasmic Membrane Systems II Lecture 12. How Do Proteins Get Imported Into Membrane Enclosed Organelles? Import Requires Input of Energy to Occur!
Lecture 6 - Intracellular compartments and transport I.
A view of the eukaryotic cell: Elaborately compartmentalized systems *Generalized animal cell *Generalized plant cell.
Protein trafficking between membranes By Graham Warren & Ira Mellman
ROUGH ENDOPLASMIC RETICULUM
Lecture 2: Protein sorting (endoplasmic reticulum) Dr. Mamoun Ahram Faculty of Medicine Second year, Second semester, Principles of Genetics.
Extra credit for Midterm 2
GOLGI APPARATUS STRUCTURE  Unique structure that some say looks like a maze, but the structure is actually made of stacks of flattened membranous sacs,
Summary 1.Rough ER and smooth ER; 2.Signal hypothesis, translocation into ER; 3.Single-span and multi-span membrane proteins; 4.Glycosylation; 5.Protein.
Cell Architecture. CELL THEORY Mathias Schleiden and Theodore Schwann Prokaryotic cell Eukaryotic cell – plant cell and animal cell Figure 9-1.
The Secretory Pathway Becky Dutch Molecular and Cellular Biochemistry 1. ER - translation 2. ER- protein modifications 3. Discussion Section 4. Golgi apparatus.
© 2003 By Default!Slide 1 Protein Sorting, Transport and modification part1 M. Saifur Rohman, MD, PhD, FIHA.
Copyright © 2005 Pearson Prentice Hall, Inc. Intracellular Compartments and Transport Membrane Enclosed Organelles Protein Sorting Vesicular Transport.
ER and Golgi: Working Together! Mr. Nichols PHHS.
Previously Bio308 Hypotheses for molecular basis of bipolar disorder Suggest problem lies in protein targeting How are proteins targeted and delivered?
1 GCCTCAATGGATCCACCACCCTTTTTGGGCA GCCTCAATGGATCCACCACCCTTTTTGGTGCA AGCCTCAATGGATCCACCACCCTTTTTGGTGC AAGCCTCAATGGATCCACCACCCTTTTTGGTG CAAGCCTCAATGGATCCACCACCCTTTTTGGT.
Chapter 12 Intracellular Compartments and Protein Sorting.
PACKAGING, TRANSPORTING and EXPORTING
Biosynthesis of a Secretory Protein The starred words are made of membranes. This means that they are all composed of phospholipids Ribosome- *Rough Endoplasmic.
The purpose of cell is to CREATE PROTEINS. Plasma Membrane Cell membrane; outer layers of the cell made up of lipid bilayer and proteins “selectively.
Vesicular Trafficking Movement From the ER Through the Golgi.
Cytoplasmic membranes-1 Unit objective: To understand that materials in cell are shuttled from one part to another via an extensive membrane network.
Lecture 12: The secretory pathway
Protein targeting or Protein sorting Refer Page 1068 to 1074 Principles of Biochemistry by Lehninger & Page 663 Baltimore Mol Cell Biology.
The ER and Golgi Modify & Sort Proteins
Figure Molecular Biology of the Cell (© Garland Science 2008)
Figure 14-1 Molecular Biology of the Cell (© Garland Science 2008)
1.6 Parts of cell seen with an electron microscope.
Why organelles? Specialized structures specialized functions cilia or flagella for locomotion Containers partition cell into compartments create different.
Intracellular Vesicular Traffic
Intracellular Compartments and Protein Sorting
Endomembrane system and vesicular transport
Protein Synthesis and Sorting: A Molecular View
Molecular Biology of the Cell
The Cytomembrane System
Protein Sorting & Transport
Vesicular Trafficking
Intracellular Vesicular Traffic
Fig
Vesicular transport Dr. med. habil. Kőhidai László Assoc. Professor
Structure & Function of eukaryotic organelle
Intracellular Vesicular Traffic
INTD5000, REVIEW, Lectures C7-C8
Intracellular Transport Pathways
Intracellular Compartments and Protein Sorting
Golgi apparatus Jermaine and Bianca.
structure & function of eukaryotic organelle
Intracellular Compartments and Transport
Active Transport Uses ATP to move solutes across a membrane
ROUGH E.R By:ISAIAH HAIRSTON.
Nat. Rev. Neurol. doi: /nrneurol
Chapter 13 Intracellular Vesicular Traffic.
Chapter 12 Intracellular Compartments and Protein Sorting
Intracellular Compartments and Vesicular Trafficking
Intracellular Compartments and Protein Sorting
Figure 5-1 Molecular Biology of the Cell (© Garland Science 2008)
Presentation transcript:

Intracellular Trafficking How proteins know where to go

Nucleus Nuclear import & Export

+

Mitochondria Import to the Mitochondrial Matrix & Intramembranous Space

- - - - - - - - + + + + + + + + - - - - - - - -

Endoplasmic Reticulum Sorting to the ER lumen & Insertion in the ER membrane

hydropathy plot H2N COOH

NH2 COOH H2N COOH NH2 COOH

hydropathy plot H2N COOH

Endoplasmic Reticulum Modification at the ER and Folding of Soluble Proteins

“Post-translational modifications” = co-translational glycosylation addition of lipids protein folding (removal of signal peptide)

“consensus sequence” = Asn-X-Ser/Thr N-linked glycosylation “consensus sequence” = Asn-X-Ser/Thr

Protein Folding

ER “Retention” KDEL = Lys-Asp-Glu-Leu-C term

Vesicular Transport Secretory Pathway

“constitutive secretory pathway”

COP = Coatomer Protein

Endocytosis Exocytosis

Figure 13-13b Molecular Biology of the Cell (© Garland Science 2008)

Sar 1 hydrolyzes GTP GDP Sar 1 is no longer in the vesicle membrane Sec proteins no longer coat the vesicle (i.e., coat disassembles) Figure 13-13d Molecular Biology of the Cell (© Garland Science 2008)

Rab Proteins SNARE Proteins

Figure 13-16 Molecular Biology of the Cell (© Garland Science 2008)

Figure 13-17 Molecular Biology of the Cell (© Garland Science 2008)

Page 779 Molecular Biology of the Cell (© Garland Science 2008)

Figure 13-43 Molecular Biology of the Cell (© Garland Science 2008) P

lysosome pH decrease Figure 13-44 Molecular Biology of the Cell (© Garland Science 2008)

Feedback: Privacy Policy Feedback
Do Not Sell My Personal Information
About project: SlidePlayer Terms of Service

© 2025 SlidePlayer.com. Inc. All rights reserved.