Forensic DNA Analysis M. Phillips, 2014

STR: Short Tandem Repeat STR: Short Tandem Repeat. A section of DNA with 2-10 base pairs repeated back to back. Has forensic value because STRs vary from person to person VNTR: Variable Number Tandem Repeat. Similar to an STR, but are longer. Locus: A section of DNA used for comparison between individuals. PCR: Polymerase Chain Reaction. Process invented to amplify (copy) a small amount of DNA. Works just like replication in the nucleus, but much faster.

Restriction Enzyme: An enzyme derived from bacteria that acts as “molecular scissors” to cut DNA at a recognized site. Restriction Site: A section of DNA that acts as a “dotted line” and tells the restriction enzyme where to cut Restriction Fragment: The piece of DNA that has been cut out of the DNA by a restriction enzyme

Objectives of Forensic DNA Testing 11/10/2018 To link an individual to a crime scene/criminal act To exonerate suspects To identify victims of mass disasters Identify stolen biological property (poaching of plants and animals, kidnapping) Mass disasters can be either manmade (9/11 act of terrorism) or natural (2005 Indian Ocean Tsunami, 295,000 dead)

Mid-1980s: The Colin Pitchfork Case 11/10/2018 Mid-1980s: The Colin Pitchfork Case Two young women raped and murdered in Narborough, England 5,000 local men are asked to provide blood/saliva samples 1st exoneration and conviction on forensic DNA evidence “The Blooding” by Joseph Wambaugh, retired LAPD Sergeant

Basic Principles The human genome is really, REALLY big We use restriction enzymes to cut out sections from pre-determined areas to make it easier to compare samples Sometimes we don’t have enough of a sample and we use a process called PCR to make more The samples are labeled with a radioactive probe and sorted by size. Then the “DNA fingerprints” can be compared.

human genome 3.2 billion bases TACGCACATTTACGTACGCGGATGCCGCGACTATGATCACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACTCGACTAGCATGATCGATCAGCTACATGCTAGCACACYCGTACATCGATCCTGACATCGACCTGCTCGTACATGCTACTAGCTACTGACTCATGATCCAGATCACTGAAACCCTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACT human genome 3.2 billion bases

 How do we cut DNA? Restriction enzymes discovered in 1960s evolved in bacteria to cut up foreign DNA “restrict” the action of the attacking organism 

What do you notice about these phrases? radar racecar Madam I’m Adam Able was I ere I saw Elba a man, a plan, a canal, Panama Was it a bar or a bat I saw? go hang a salami I’m a lasagna hog palindromes

Restriction enzymes Action of enzyme Many different enzymes Madam I’m Adam Action of enzyme cut DNA at specific sequences restriction site symmetrical “palindrome” produces protruding ends sticky ends will bind to any complementary DNA Many different enzymes named after organism they are found in EcoRI, HindIII, BamHI, SmaI  CTGAATTCCG GACTTAAGGC  CTG|AATTCCG GACTTAA|GGC

Restriction enzymes GTAACGAATTCACGCTT CATTGCTTAAGTGCGAA restriction enzyme cut site GTAACGAATTCACGCTT CATTGCTTAAGTGCGAA restriction enzyme cut site GTAACG AATTCACGCTT CATTGCTTAA GTGCGAA

Sticky ends GTAACG AATTCACGCTT CATTGCTTAA GTGCGAA GGACCTG AATTCCGGATA Cut other DNA with same enzymes leave “sticky ends” on both can glue DNA together at “sticky ends” GTAACG AATTCACGCTT CATTGCTTAA GTGCGAA gene you want GGACCTG AATTCCGGATA CCTGGACTTAA GGCCTAT chromosome want to add gene to GGACCTG AATTCACGCTT CCTGGACTTAA GTGCGAA combined DNA

Few Restriction Enzymes Enzyme Organism from which derived Target sequence (cut at *) 5' -->3' Bam HI Bacillus amyloliquefaciens G* G A T C C Eco RI Escherichia coli RY 13 G* A A T T C Hind III Haemophilus inflenzae Rd A* A G C T T Mbo I Moraxella bovis *G A T C Pst I Providencia stuartii C T G C A * G Sma I Serratia marcescens C C C * G G G Taq I Thermophilus aquaticus T * C G A Xma I Xanthamonas malvacearum C * C C G G G

How does it Look after Restriction Digestion? How does it Look after Restriction Digestion? Genomic DNA Digest Plasmid DNA Digest

Early 1980s: Restriction Fragment Length Polymorphism (RFLP) 11/10/2018 Early 1980s: Restriction Fragment Length Polymorphism (RFLP) Genetic variation in the distance between restriction enzyme sites Template DNA digested by enzymes, electrophoresed, detected via Southern blotting Sir Alec Jeffreys “Please just call me Alec.”

11/10/2018 The Catch: RFLP testing requires a relatively large amount of DNA (~50ng = thousands of cells) Not ideal for forensic evidence, in which small, degraded samples are common

PCR To The Rescue! Polymerase Chain Reaction = molecular Xeroxing 11/10/2018 PCR To The Rescue! Polymerase Chain Reaction = molecular Xeroxing Three temperature phases, carried out in a Thermal Cycler, replicate or “amplify” the desired DNA fragment(s) Dr. Kary Mullis Eccentric Genius

PCR http://www.youtube.com/watch?v=2KoLnIwoZKU

So how do we know which section to copy? DNA has about 3 billion base pairs with about 3 million differences between any two individuals.

STRs http://vimeo.com/69239594 STR – short tandem repeat in DNA Occurs when a pattern of TWO or more nucleotides are repeated and the repeated sequences are adjacent to each other. Pattern can range in length from 2 to 10 bp Count how many repeats of a specific STR at a given locus can create unique genetic profile Currently over 10,000 published STR sequences in human genome

VNTRs Very similar to STRs, but longer nucleotide sequences STRs are therefore more efficient for amplification

Applied Biosystems 310 Genetic Analyzer 11/10/2018 Applied Biosystems 310 Genetic Analyzer

The Process In a Nutshell 11/10/2018 The Process In a Nutshell Amplified DNA samples are injected into a tube. Fluorescent tags on the DNA fragments are excited by a laser as they pass a window in the capillary, the fluorescence is recorded by a camera, and this signal is converted into a “peak” by the computer software.

11/10/2018 STR data X, Y, X Y

11/10/2018 STR data (cont’d) “The DNA profile obtained from Item 25(S) matches the DNA profile of the suspect. The combination of genetic marker types exhibited by Item 25(S) and the suspect occurs in approximately one in one hundred quadrillion (1017) individuals…”

The Combined DNA Index System (CoDIS) 11/10/2018 The Combined DNA Index System (CoDIS) A database of DNA profiles from violent felons and crime scene samples Database currently contains about 2,038,470 felons and 93,956 crime scene profiles (19,00 hits so far)

The Mystical Power of CoDIS 11/10/2018 The Mystical Power of CoDIS Extremely powerful investigative tool, linking crimes, and pulling suspects out of thin air! Can prevent, as well as solve crimes!

The Dark Side of CoDIS (What the FBI doesn’t want you to know.) 11/10/2018 The Dark Side of CoDIS (What the FBI doesn’t want you to know.) DNA mixtures and degraded DNA profiles have lead to spurious matches Stringent laws explicitly permit databasing innocent people Adding arrestees to database violates presumption of innocence However, the prosecution rate on case to offender matches is shockingly low! (~10%) DNA mixtures can be tricky; requiring close examination of the electronic data, the questioned profile, and the offender “match” profiles. For example, an unknown mixture profile with three alleles at the D21S11 locus, ex. (28, 30, 31) would “hit” on (28, 28), (28, 30), (28, 31), (30, 30), (30, 31), and (31, 31). A total of 6 genotypes. If we designate an obligate or required allele (+), (28, 30+, 31)* would now hit only on the following genotypes: (28, 30), (30, 30), and (30, 31). We have reduced the number of hits at the D21S11 locus by half. Assigning obligate alleles at as many loci as possible can reduce the number of spurious hits to the offender database. * In this example, which could be a vaginal swab taken from the victim of a sexual assault, the victim was determined to be a (28, 31) at D21S11. Therefore, the 30 allele is foreign to the victim and presumed to be from the suspect.

Mitochondrial DNA (mtDNA) Used for samples that cannot be analyzed using RFLP or STR Uses DNA extracted from mitochondrion rather than nuclear DNA Especially useful in old cases and old samples Single-cell sensitivity because each cell contains ~1000 mitochondria

Mitochondrial DNA (mtDNA) 11/10/2018 Mitochondrial DNA (mtDNA) Cons Single-cell sensitivity because each cell contains ~1000 mitochondria = very high contamination risk! Lower power of discrimination - maternal relatives all share the same mtDNA

11/10/2018 Y-STRs Solution: Test for markers found only on the Y-chromosome. Only male DNA is amplified!

Probe Identification If you know a specific section of DNA you want, you can use a probe A complementary strand of DNA or RNA is made and will stick to the target strand by base pairing rules This probe is labeled with radioactive isotopes or a fluorescing dye Value – can show different sequences/alleles in similar sized pieces of DNA

https://www.youtube.com/watch?v=1sMOv9TUiFg&t=16s