Homework: HP 6 answer reading questions

Slides:

Advertisements

Similar presentations

Advertisements

Mutations. General Definition Long Notes: Any change in DNA sequence is called a mutation. Abbreviated Notes (AN): Mutation (mut) = DNA sequence (seq)

Mutations. Hollywood’s images of mutation Mutations Actual Mutations in fruit flies.

MONSTROUS MUTATIONS!!!. What is a mutation? Mutations are changes in DNA! However, these simple changes or mistakes can cause big changes in phenotypes.

Genetic Changes 11.3.

Mutations Genetic Changes.

Genetic Mutations Increasing Genetic Diversity May 4, 2010.

Mutations Dr. Evil: I have one simple request. And that is to have sharks with frickin' laser beams attached to their frickin’ heads!... What do we have?

MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.

 During replication (in DNA), an error may be made that causes changes in the mRNA and proteins made from that part of the DNA  These errors or changes.

MUTATIONS. Mutations Mutation: A change in the DNA sequence (gene), that also changes the protein it codes for. In Sex Cells: can produce new traits or.

Mutations. Mutation effects Reproductive Cells -mutation in DNA sequence of an egg or sperm cell -mutation is passed on to offspring - possible effects.

12.4 Mutations Copyright Pearson Prentice Hall.. What Are Mutations? Changes in the nucleotide sequence of DNA (genetic material) May occur in somatic.

Mutations Mutations are changes in DNA Mutations are changes in DNA These can occur in: These can occur in: Somatic cells – can cause tumours/cancersSomatic.

Gene Regulation Ability of an organisms to control which genes are present in response to the environment.

Section 11.3: Genetic Changes

12.4 Assessment Answers.

Mutations 6/26/2018 SB2d.

11.3 Mutations.

A change in the DNA sequence that affects genetic information

Mermaid Syndrome Video.

Types of Mutations.

Copyright Pearson Prentice Hall

MUTATIONS And their effect.

Bell Ringer: 11/21/17 Objective: Explain that mutations occur during DNA replication or transcription and may be random or a result of environmental agents.

Gene Mutations.

Genetic Mutations.

A change in the DNA sequence that affects genetic information

Mutations LN #23 Ms. Garcia California Content Standard Genetics

Gene Expression & Mutations

Mutation Lecture 11 By Ms. Shumaila Azam

To be successful today…

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations -changes in a single base pair in DNA=changes in the nucleotide.

11.3 Section Objectives – page 296

Mutations Dr. Evil: I have one simple request. And that is to have sharks with frickin' laser beams attached to their frickin’ heads! What do we.

A mutation is a change in an organism’s DNA.

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations Alternative alleles (traits) of many genes result from changes.

A mutation is a change in an organism’s DNA.

SB2. The learner will analyze how biological traits are passed on to successive generations. d. Describe the relationships between changes in DNA and potential.

Distinguish between codon and anticodon.

SC.912.L.16.4 Explain how mutations in the DNA sequence may or may not result in phenotypic change. Explain how mutations in gametes may result in.

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?

Mutations changes in genetic material (_____).

Mutations Chapter 8.7

Objective: Explain the main types of mutations

13.3 Mutations.

11.3 Section Objectives – page 296

Protein Synthesis and Mutation

DNA Mutations Types & their effects.

Mutations: Changes in Genes

Presentation transcript:

Why would a mutation in a skin cell not be passed on to future generations? Homework: HP 6 answer reading questions DNAProtein Unit Exam on Friday Study guide given out today!

Types of Mutations 1. Frameshift- results from the addition or deletion of a nucleotide This will cause a shift in every codon after the addition or deletion Usually more damaging than a point mutation 2. Point Mutation- results from the substitution of a nucleotide

What causes DNA mutations? Random-DNA replication is very complicated and sometimes mistakes occur. Radiation- The energy in radiation can actually break or damage nucleotides in a DNA strand UV rays Chemical Exposure- Chemicals can break or damage bonds between nucleotides in DNA Ethidium Bromide

UV Radiation UV Radiation causes breaks in the DNA strands that can result in cancer https://www.youtube.com/watch?v=zI2vRwFKnHQ

UV Radiation Causes Mutations

UV radiation and skin cancer Why is UV radiation mostly associated with skin cancer?

UV Radiation and Cancer

Mutations Flow Charts 1st box: DNA mutation/DNA changed Last box: Mutation passed on/not passed on to next generation

UV Radiation and Ethidium Bromide Reading Complete on a legal size sheet of paper Complete at least 1 per group!