Is AT2G23290 Important in Seed Development?

Slides:

Advertisements

Similar presentations

Arabidopsis thealiana AT3G56230 AT4G18650 What are the functions of them? Are they important for seed development? Spring 2004 Mariko Onozawa.

Advertisements

The Trihelix Transcription Factor Family Heather Hernandez.

HC70AL Presentation: Gene-Knockout Analysis Arabidopsis Thaliana

Zinc Finger CONSTANS- Related and LOB-Domain Containing Genes Nancy Phang June 4, 2004.

What are the Methods and Approaches Used to Identify and Study Arabidopsis Seed Knock- Out Mutations? Eric Newton Garen Polatoglu Rena Schweizer.

At5g A mutant phenotype? Emily Eder HC70AL - Spring 2005.

Heredity: The study of genetics started with observations made by GREGOR MENDEL, a monk who noticed that pea plants passed certain traits from one generation.

Sex – Linked Traits. Objectives for the day Conduct sex-linked punnett square. Identify which sex chromosomes are mostly responsible for sex-linked disorders.

HC70AL Spring 2009 An Introduction to Bioinformatics By Brandon Le & Min Chen April 7, 2009.

Unit 2: Genetics. Genes: the blueprint for proteins Genetics: the study of how inheritable characteristics are passed on from generation to generation.

The MYB and BHLH Transcription Factor Families by Elaine Chiu.

Natural Variation in Arabidopsis thaliana Light Response: Genomic Approaches Justin Borevitz Salk Institute naturalvariation.org.

BHLH - Basic Helix Loop Helix Family Protein Emily Eder HC 70AL - Spring 2005.

Arabidopsis Gene Project GK-12 April Workshop Karolyn Giang and Dr. Mulligan.

Bikash Shakya Emma Lang Jorge Diaz.  BLASTx entire sequence against 9 plant genomes. RepeatMasker  55.47% repetitive sequences  82.5% retroelements.

Genetics Ms Mahoney MCAS Biology. Central Concepts: Genes allow for the storage and transmission of genetic information. They are a set of instructions.

F-Box Containing Tubby Transcription Factor Family Daisy Robinton Goldberg Lab Spring 2006.

HC70AL Final Presentation Chris McQuilkin June 4 th, 2009.

What Makes the “Blue” in Blueberries? -The Truth about Myb Dylan Coughtrey Laboratory Methods in Genomics Spring 2011.

Genes That Direct Transcription Co-activator Proteins : Do they disrupt/alter seed development? Gene 1: At5g09250 Gene 2: At5g09240 Combiz Richard Abdolrahimi.

The SET-Domain Containing Protein and MYB-related Families: Genes AT2G05900 & AT1G17460 Kristin Gill HC70AL Spring 2008.

The HAT2 Homeodomain-Like Transcription Factor Family: Genes AT5G47370 and AT4G17460 Bekah Charney HC70AL Spring 2006.

Ctcgaacttgtttttggttcatctctcaaaaccaaaatcactaaagaggagaagattgctaaagtttgataaaacattccaaaatca ATGGCTGATAGGATCAAAGGTCCATGGAGTCCTGAAGAAGACGAGCAGCTTCGTAGGCTTGTTGTTAAATACGGTCCAAGAAACTGG.

THE FUNCTION OF AT5G04410 (NAC2) AND AT3G10500 (NAC2-like) NAC Family

Daisy Robinton Matt Emmer Jason Chai

The Role of Genes AT5G48150 and AT2G04890 in Arabidopsis thaliana Seed Development Jennifer Huynh June 8, 2006 Honors Collegium 70AL Professor Bob Goldberg.

The C3HC4-Type RING Zinc Finger and MYB Transcription Factor Families Matthew Taube June 5, 2008 HC70AL.

Homeobox leucine zipper protein 9 (HAT9) -AT2G Homeodomain(s) -Leucine Zipper Motif -DNA Binding -Dimerization ?? ~ Helix-turn-helix 5’3’ FWRV.

Genetics & Genotyping By Kristin Gill & Daisy Robinton HC70AL Spring 2009.

SRB Genome Assembly and Analysis From 454 Sequences HC70AL S Brandon Le & Min Chen.

Determining Functionality of Arabidopsis Thaliana Genes in Embryo Development Ria Yagnik.

Arabidopsis Thaliana A Study of Genes and Embryo Development By Garen Polatoglu.

Is My Gene Important for Seed Development in Plants?? Gene: AT3G53370 Jonathan Milgrom Spring 2004.

Myb Transcription Factors Dylan Coughtrey Laboratory Methods in Genomics Spring 2011.

Genomic Characterisation of Nitrogen Assimilation Genes in Cassava (Manihot esculenta Crantz) T.G. Chabikwa, M.E Rauwane, and D.A Odeny ARC-Biotechnology.

SC.912.L.16.3 DNA Replication. – During DNA replication, a double-stranded DNA molecule divides into two single strands. New nucleotides bond to each.

Supplemental Fig. S1 A B AtMYBS aa AtMYBS

Searching for the Genes that Control Seed Development

Are At1g08810 and At3g50060 Important to Arabidopsis Seed Development?

Emily Eder HC70AL - Spring 2005

Dihybrid cross Used when looking at inheritance patterns of 2 genes on different chromosomes Independent assortment will separate the 2 homologous chromosomes.

SEX-LINKED GENES.

SEX-LINKED GENES.

Welcome to the world of two Arabidopsis genes:

The Alfin-like PHD Zinc Finger Transcription Factor Family

Does Gene AT5G19490 Play a vital role in seed development?

HC70AL Final Presentation

Put Your Dukes Up AT5G03220! Studying Embryo Lethality of

HC70AL Oral Presentation

Relationship between Genotype and Phenotype

What is AT5G03500? --Background and Structure--

At2G37120: A Gene Exploration

#50 Using a Punnett Square

Searching for a Knockout Line for a Gene of Interest in Arabidopsis

Relationship between Genotype and Phenotype

HC70AL Research Presentation

Deoxyribonucleic Acid

BIOLOGY EOC REPORTING CATEGORY : 2.

Gene structures, positions of mutations, and protein domains of PRP18 paralogs in Arabidopsis. Gene structures, positions of mutations, and protein domains.

Heat Shock Factor Protein Family of Transcription Factors

Punnett Square Practice Problems.

Arabidopsis Thaliana Gene AT5G58610

Mendel & Genetics

Chapter 12 test study guide and review

Arabidopsis Gene At1G49560 Maria Garcia June 5, 2008.

Traffic light activity Genetic Variation

Searching for a Knockout Line for a Gene of Interest in Arabidopsis

GENETICS HEREDITY.

Friday, oct 13th Get your binder You need:

Presentation transcript:

Is AT2G23290 Important in Seed Development? us.expasy.org/sprot/ppap/ Professor Goldberg Tiffany Sum HC 70AL Spring 2004 http://plantsci.nottingham.ac.uk/undergraduate/arabidopsis.jpg

What Is AT2G23290? BLASTX: myb family transcription factor 3’ FW RV 5’ -188 1 96 1027 1134 1376 BLASTX: myb family transcription factor 305 amino acids SRB EST: 89% match Potato (Solanum tuberosum)

What Is AT2G23290? Chromosome 2 Reverse Complementary Orientation 5’ 3’ 1 1134 -8600 700

Scarlet Runner Bean (SRB) Where Is AT2G23290 Active? Scarlet Runner Bean (SRB)

Arabidopsis Thaliana

Are There Knockouts in My Gene? Green: SALK Red: Madison 054253 047973 28 FW 5’ 3’ FW RV 112345

Madison – Where Is the Knockout? FW+T-DNA RV+T-DNA

SALK – What Are the Genotypes of My Seedlings? FW+RV FW+T-DNA Chi squared value: 13.44 Probability: < 0.5% 1 2 3 4 5 6 7 8 9 T/T +/+ +/T

What Are The Phenotypes? More to come…