Human Body Organization

Slides:



Advertisements
Similar presentations
DNA RNAProtein Synthesis.
Advertisements

C-26 Genetics Packet. What are most homologous chromosomal pairs called? Homozygous or Pure.
Nucleic Acids, DNA Replication, and Protein Synthesis
DNA and Gene Expression. DNA Deoxyribonucleic Acid Deoxyribonucleic Acid Double helix Double helix Carries genetic information Carries genetic information.
Chromosomes carry genetic information
Nucleic Acids: The Molecules of Life. DNA and RNA Both are polymers. They are made up of monomers called nucleotides.
EOC Vocab List # This type of cell division produces 4 genetically different haploid gametes.
An Introduction to Genes and Genomes. BOGGLE When the timer begins, try to construct as many words as possible using the given letters. You may go in.
DNA.
C-11 Review for test.. WHAT BASE ALWAYS PAIR WITH ADENINE IN DNA? THYMINE.
1 10 pt 15 pt 20 pt 25 pt 5 pt 10 pt 15 pt 20 pt 25 pt 5 pt 10 pt 15 pt 20 pt 25 pt 5 pt 10 pt 15 pt 20 pt 25 pt 5 pt 10 pt 15 pt 20 pt 25 pt 5 pt DNA.
Chapter 12 Making Proteins. Differences between RNA and DNA DNA = double strand; RNA = single strand RNA contains Ribose instead of deoxyribose. RNA uses.
Life Science “The Molecular Basis of Heredity”. Amino Acid Any of the organic acids that are the chief component of proteins, either manufactured by cells.
1. Chemical 2. Cellular 3. Tissue 4. Organ 5. Organ System 6. Organismic Human Body Organization.
Human Body Organization
Cell Reproduction and Division How do cells get here?
1. Chemical 2. Cellular 3. Tissue 4. Organ 5. Organ System 6. Organismic Human Body Organization Levels.
Blueprints of life Discussion Question Review Question.
Gene Expression How do genotypes become phenotypes? 23 from mom 23 from dad.
Double Helix DNA consists of two strips, made of sugars and phosphates, twisted around each other and connected by nitrogen bases. Looks like a spiral.
DNADNA eoxyribo ucleic cid …and some really cool Genetics too!
Protein Synthesis Levels of Genetic Organization.
DNA Deoxyribose Nucleic Acid – is the information code to make an organism and controls the activities of the cell. –Mitosis copies this code so that all.
Biology Ch. 11 DNA and Genes DNA  DNA controls the production of proteins Living tissue is made up of protein, so DNA determines an organism’s.
Lipid Bilayer Phospholipids make up the outer layer of all cells.
DNA and RNA DNA and RNA. DNA DNA -Deoxyribonucleic acid DNA -Deoxyribonucleic acid The nucleic acid that stores and transmits the genetic information.
Modern Genetics How information is passed from parents to offspring.
Biochemical Composition Evidence of Evolutionary Relationships.
Biochemical Composition Evidence of Evolutionary Relationships.
You are what you eat!.  Deoxyribonucleic Acid  Long, double-stranded chain of nucleotides  Contains genetic code  Instructions for making the proteins.
DNA & Cell Cycle TEST REVIEW. The time when a cell is eating, breathing, growing… Interphase.
DNA, RNA, and PROTEIN SYNTHESIS DNA, genome, instructions, blueprint, chromosomes, genes All MEAN DNA!!!! THEY ALL HAVE TO DO WITH DNA DNA is a molecule.
Transcription and Translation
SC.912.L.16.3 DNA Replication. – During DNA replication, a double-stranded DNA molecule divides into two single strands. New nucleotides bond to each.
Bellringer What does Protein do?
Biology Review Benchmark Test #3
What is a genome? The complete set of genetic instructions (DNA sequence) of a species.
Protein Synthesis.
Life’s Instruction Manual or What Genes are Made Of
DNA, Protein Synthesis and Biotechnology EOC Review
DNA and Heredity DNA Structure and Function - Amoeba Sisters
The Double Helix.
Animal Cell Chromatin.
Basic Biology Review.
DNA and RNA Pages
Nucleotide.
BIOLOGY Vocabulary Chapter 12 & 13.
Ch 12 DNA and RNA.
DNA Reflection After viewing and hearing your classmates presentations, and making you own, what do you specifically understand and what do you not specifically.
DNA and Heredity DNA Structure and Function - Amoeba Sisters
DNA and Heredity DNA Structure and Function - Amoeba Sisters
UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms?  Mutations Alternative alleles (traits) of many genes result from changes.
DNA and Heredity Module 6.
DNA, Protein Synthesis and Biotechnology EOC Review
Life’s Instruction Manual or What Genes are Made Of
Week 6 Vocab Definitions
DNA, Meiosis, Protein synthesis and Karyotype
RNA DNA Synthesis Mutations Protein Synthesis
DNA and Heredity DNA Structure and Function - Amoeba Sisters
Human Body Organization
REVIEW DNA DNA Replication Transcription Translation.
RNA DNA Synthesis Mutations Protein Synthesis
Unit 7: Molecular Genetics
…and some really cool Genetics too!
Week 3 and 4 vocabulary January 14, 2013.
DNA and RNA Pages
DNA and Heredity Module 6.
DNA, RNA, and Proteins.
Presentation transcript:

Human Body Organization Levels 1. Chemical 2. Cellular 3. Tissue 4. Organ 5. Organ System 6. Organismic

Chemical Level Elements Molecules Compounds Macromolecules Ions H C O NaCl KCl Ions Na+ K+ Cl- Ca++ Mg++ Molecules O2 CO2 C6H12O6 Macromolecules Proteins amino acids Lipids fatty Acids Carbohydrates monosaccharides Nucleic Acids nucleotides

Cellular Level Chromatin

Tissue Level Epithelial Tissue Connective Tissue Muscular Tissue Nervous Tissue

Organ Level Gastrointestinal Tract 1. Mouth Accessory Structures 2. Pharynx 3. Esophagus 4. Stomach 5. Small Intestine 6. Large Intestine Accessory Structures 1. Teeth 2. Tongue 3. Salivary Glands 4. Liver 5. Gallbladder 6. Pancreas

Organ System Level

Organismic Level Darwin sails around the world and in South America is puzzled by the absence of rabbits. Instead he finds these rabbit-like Patagonian Hares or Mara (Dolichotis patagonum) that are not rabbits but have similar characteristics as rabbits. He postulates that they must have evolved just like rabbits because of their similar environments

Animal Cell Chromatin

DNA (deoxyribonucleic acid) Bases/Base Pairs Nucleotides 1. 2. 3. Nitrogenous Base Base Pairs: A – T C – G

DNA Organization Chromatin organized: DNA Histones One Duplicated Chromosome

Human Chromosomes A Pair of Duplicated Chromosomes Autosomes Sex Chromosomes 46 individual chromosomes / 23 pairs of chromosomes they are the same - code for same type of trait they are different - code for different version of trait

Understanding the Numbers 1 chromosome is 1 large DNA molecule a gene is a specific sequence of nucleotides ATTCCGTAGCTGATCGTAAAGGG 1000-2000 genes per chromosome ~25,000 - 30,000 genes per human genome

DNA Functions Pass on Genetic Material Replication Protein Synthesis Mitosis Meiosis Protein Synthesis Transcription Translation

Mitosis

Replication Making an exact copy of DNA Occurs just prior to cell division Double helix unwinds DNA polymerase adds bases Two exact copies are made

Embryongenesis - Week 1 Blastocyst Inner Cell Mass (Embryonic Stem Cells) Pluripotent Stem Cells

Embryogenesis Week 2 Embryonic Germ Cell Layers: Endoderm Mesoderm Ectoderm Multipotent Stem Cells

Cell Migration Growth Cone

Radial Glia Act like scaffolding to assist movement of neurons during development

Differentiation

Protein Synthesis Transcription DNA to mRNA Translation mRNA to Protein

From Gene to Protein DNA RNA Protein

Genetic Code Codons three base code Code for specific amino acids

Point Mutation Spontaneous Mutation Environmental Insult Mutagenesis Carcinogenesis Mutation is corrected

Point Mutation Mutation is not corrected Mutation is corrected

Sickle-Cell Anemia Mutation

Sickle-Cell Anemia Mutation

Two-Hit Hypothesis Born with 2 genes or alleles for any given disease: one from mom one from dad If one is bad, this increases your chance of getting the disease

Cancer in Women

Lung Cancer