DNA By: Mr. Kauffman

Outline DNA background information Discovering DNA DNA structure How DNA works Storing DNA

DNA Background Information DNA: Deoxyribonucleic Acid DNA is the genetic/hereditary material found in all cells Stored in the nucleus Contains the information that determines what we look like

DNA Background Information Contains the information to control a cell’s growth and function, but… Only tells how to make things Other parts (proteins) of the cells actually do the work

DNA Background Information DNA Analogy DNA is like a cookbook It tells how to make something, but it doesn’t actually make it Your DNA contains the instructions for how to make you

DNA Background Information Every “normal” cell in your body has the same exact DNA in it Skin and muscle cells are normal cells When a cell divides, the DNA inside the cell is copied and each new cell gets 1 copy of it

Discovering DNA Scientists have known about DNA since the 1800’s 1952 Rosalind Franklin discovered that DNA was made up of 2 chains in a spiral shape 1953 James Watson and Francis Crick made a model of DNA

DNA Structure Known as a Double Helix Meaning there are 2 sides in a spiral shape More commonly called a twisted ladder

DNA Structure Outer parts of the DNA ladder are called the sugar-phosphate backbone Alternating sections of sugar and phosphate

DNA Structure The rungs of the DNA ladder are made up of nitrogen bases There are 4 types of nitrogen bases 1. Adenine (A) 2. Cytosine (C) 3. Guanine (G) 4. Thymine (T) The bases are always found in pairs Adenine (A) always pairs with Thymine (T) Cytosine (C) always pairs with Guanine (G) They fit together like puzzle pieces

DNA structure

DNA structure Draw the picture on the left in your notes Provide the base that each base you have been given would pair with A G C T

How DNA works The sequence of the DNA bases (A,C,G,T) determines the information contained in the DNA A sequence of 3 bases is called a codon ACGGCAATTGCTTTTAAGCCA ACG , GCA , ATT , GCT , TTT, AAG , CCA

20 Amino Acids Amino Acid DNA Codon Isoleucine ATT, ATC, ATA Serine TCT, TCC, TCA, TCG, AGT, AGC Leucine CTT, CTC, CTA, CTG, TTA, TTG Tyrosine TAT, TAC Valine GTT, GTC, GTA, GTG Tryptophan TGG Phenylalanine TTT, TTC Glutamine CAA, CAG Methionine ATG Asparagine AAT, ACC Cysteine TGT, TGC Histidine CAT, CAC Alanine GCT, GCC, GCA, GCG Glutamic Acid GAA, GAG Glycine GGT, GGC, GGA, GGG Aspartic Acid GAT, GAC Proline CCT, CCC, CCA, CCG Lysine AAA, AAG Threonine ACT, ACC, ACA, ACG Arginine CGT, CGC, CGA, CGG, AGA, AGG

Storing DNA DNA is stored in the nucleus of the cell Stored as chromosomes How many chromosomes do humans have? Every “normal” human cell has 46 single chromosomes, or 23 pairs of chromosomes Each chromosome contains DNA with different information in it

Human Chromosome Chart Storing DNA Human Chromosome Chart

Actual Human Chromosomes Storing DNA Actual Human Chromosomes