Notes over Active Transport and Protein Synthesis Objective: I can explain the structure of RNA and process of transcription and translation. Agenda: Notes over Active Transport and Protein Synthesis Protein Synthesis Activity Exit Ticket

ENDOCYTOSIS & EXOCYTOSIS

requires

Exocytosis and Endocytosis The fusion of a vesicle with the cell membrane, releasing its contents to the surroundings Endocytosis _______________ The formation of a vesicle from cell membrane, enclosing materials near the cell surface and bringing them into the cell

ENDOCYTOSIS Endocytosis: (“Endo” means __________ Endocytosis is the taking in of molecules or particles by invagination of the cell membrane forming a vesicle. __________________

ENDOCYTOSIS There are two types of endocytosis: 1. _____________ (cell drinking): small molecules are ingested and a vesicle is immediately formed. This is seen in small intestine cells (villi) 2. _____________ (cell eating): large particles, (visible with light microscope) are invaginated into the cell (ie: white blood cells ‘eat’ bacteria).

phagocytosis

EXOCYTOSIS Exocytosis: (“Exo” means “out”.) __________________________. This is where a cell releases the contents of a vesicle outside of the cell. These contents may be wastes, proteins, hormones, or some other product for secretion. ____________________ Example: vesicles from the Golgi fuse with the plasma membrane and the proteins are released outside of the cell.

Membrane Cycling Exocytosis and endocytosis continually replace and withdraw patches of the plasma membrane New membrane proteins and lipids are made in the ER, modified in Golgi bodies, and form vesicles that fuse with plasma membrane

Do you remember what Proteins are made of? Hundreds of Amino Acids link together to make one Protein There are 20 types of amino acids that can make up the proteins in our bodies. There are infinite combinations of Amino Acids Can be hundreds or thousands monomers long These long chains are called polypeptide chains

Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message contained within its DNA. However… _______________________ __________________________________________________________________ Houston, we have a problem.

Protein Synthesis How do the many different messages within the DNA molecule get to the many ribosomes outside the nucleus? A molecular cousin of DNA – RNA – is used to carry these messages.

Ribonucleic Acids (RNA) The job of ________ (ribonucleic acid) is to carry messages from the DNA (in the nucleus) to the ribosomes (in the cytoplasm). There are three types of RNA: _______– carries a message from the DNA to the cytoplasm _______ – transports amino acids to the mRNA to make a protein ________– make up ribosomes, which make protein.

Ribonucleic Acids (RNA) RNA is almost exactly like DNA, except: Contains a ribose sugar, instead of a deoxyribose sugar (hence the name…) Contains_________instead of thymine. RNA is single-stranded, not double-stranded

Ribonucleic Acids (RNA)

Protein Synthesis Occurs in TWO steps: __________ – the genetic information from a strand of DNA is copied into a strand of mRNA __________ – the mRNA, with the help of the ribosome, forms a chain of amino acids (eventually forming a protein) based on the information contained on the mRNA.

The Central Dogma This order of events is called the central dogma of molecular biology: DNA RNA P R O T E I N

Step 1: Transcription ___________: enzymes split apart base pairs and unwind the DNA double helix. ___________: Free nucleotides in the cell find their complementary bases along the new strands with the help of RNA polymerase. What will be different?? New backbone formed: The sugar-phosphate backbone is assembled to complete the RNA strand, and separates from the DNA strand.

TACGCATGACTAGCAAGTCTAACT Step 1: Transcription Try it! What RNA strand will be made from the following DNA sequence? TACGCATGACTAGCAAGTCTAACT

TACGCATGACTAGCAAGTCTAACT ________________________ Step 1: Transcription Try it! What RNA strand will be made from the following DNA sequence? TACGCATGACTAGCAAGTCTAACT ________________________

Step 2: Translation - “to decode or decipher the meaning of” Now that our mRNA molecule has been made, it’s time for its message to be made into a protein sequence. How does the mRNA sequence translate into an amino acid sequence?

Step 2: Translation Problem: There are 20 different amino acids. There are ______RNA bases. How do you end up with a completed protein? A T C G phe ile val pro ala his asn asp cys arg leu met ser thr tyr gln lys glu trp gly

Step 2: Translation Conversion of RNA into amino acid sequence that makes a protein 1. The mRNA leaves the nucleus and enters the cytoplasm 2. _________________________ 3. tRNA (carrying anti-codon) picks up the correct amino acids and carries them to the mRNA strand forming the protein

Breaking the Genetic Code: So how do you exactly go about determining what protein your cells are going to make? FIRST, Divide the mRNA sequence into codons. As you just saw and heard, codons are three-base sections of mRNA: AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

Step Two: Translation AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA ? Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon. ? AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

The Genetic Code

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA ? met

The Genetic Code

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA met arg thr asp arg ser asp ???

The Genetic Code

AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon. In the end, you have a completed protein to be transported to the cell! AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA met met thr asp arg ser asp STOP

RECAP: DNA is transcribed into mRNA in the nucleus. The mRNA leaves the nucleus and enters the cytoplasm. The protein is translated from the mRNA sequence using tRNA, rRNA, and amino acids.

Mutations 2007-2008

Mistake or change in DNA sequence mistakes in completed DNA are Mutation: Mistake or change in DNA sequence mistakes in completed DNA are 1 in 1 billion

Chromosomal Alterations Chromosomal mutations--Structural changes in chromosomes Are especially common in plants. 4 main types— _____________________________________________

Mutations Point mutations single base change base-pair substitution ________ no amino acid change redundancy in code ______ change amino acid _________ change to stop codon When do mutations affect the next generation?

Point mutation leads to Sickle cell anemia What kind of mutation? Missense!

Sickle cell anemia Primarily Africans recessive inheritance pattern strikes 1 out of 400 African Americans

Mutations Frameshift shift in the reading frame insertions deletions __________________________________ Not usually triplets anymore insertions ___________ deletions _______________-

Point vs. Frameshift Mutations Which type of mutation is more serious? _________________________________________________ ___________________________________________