DNA Replication - Review Helicase unzips double helix. Hydrogen bonds between nitrogen bases are broken. DNA Polymerase brings in new nucleotides using the parent strand as a template. A matches with T C matches with G Every 3 nucleotides codes for an amino acid. Amino acids  Protein

Protein Synthesis

Protein Synthesis: Big Picture

RNA RNA (ribonucleic acid) Single-stranded (not double-stranded) Contains ribose sugar (not deoxyribose) Contains Uracil (instead of Thymine)

RNA 3 Types of RNA: mRNA (messenger RNA) Complementary copy of DNA. Moves from nucleus to ribosome. Codon: 3 nitrogenous bases (codes for an amino acid) tRNA (transfer RNA) Transfers amino acid to ribosome. Contains amino acid & anti-codon: 3 bases (complement to mRNA codon) rRNA (ribosomal RNA) Makes up the ribosome.

Ribosome Ribosome: Protein factory Contains 2 subunits. Made of rRNA and protein.

Transcription Transcription: mRNA makes a copy of a DNA segment. Location: Nucleus RNA polymerase adds nucleotides. *Don’t forget: U is used instead of T Example:

Translation Translation: mRNA is used as a template to create proteins. mRNA travels from the nucleus to the cytoplasm. The two ribosome subunits clamp onto the mRNA. tRNA brings an amino acid to the ribosome. tRNA’s anticodon bonds to its complementary mRNA codon (this is called base pairing). Amino acids are attached together with peptide bonds to form proteins (polypeptides).

Translation 64 possible mRNA codons: Different codons can code for the same amino acid There are only 20 amino acids. Others code for instructions: START codon: AUG (also codes for methionine) STOP codon: UAA (does not code for an amino acid)

Common Origin of Life ALL organisms use the same genetic code  Evidence that all life evolved from a common origin.

Translation Example – Make a Protein!  mRNA strand: AUG CCC CUU AAA GAG UUU ACA UAU UGC UGG AGG CGU UAA    Protein:

Translation Practice mRNA: AUGCUUUUAGCACGACAACAAUGUUGA Protein: mRNA: AUGUAUCAAGAUGAUACAGUUUUUUAG Protein: DNA: TACGGTCATCGTGCA mRNA: Protein: DNA: TACGGCAATATT mRNA: Protein:

Strawberry DNA Lab Instructions 1. Place one strawberry in a ziplock baggie. 2. Smash strawberry with fist for 2 minutes. 3. Add 10 mL extraction buffer. - Contains detergent to break down phospholipid bilayers (plasma membrane & nuclear membrane). - Contains salt (NaCl) to break down protein chains that hold together the nucleic acids (DNA) 4. Mush again for 1 minute. 5. Filter through cheesecloth into a beaker. 6. Pour filtered strawberry juice into test tube so it is 1/8 full. 7. Slowly pour ice-cold ethanol into test tube until test tube is half full. - Cold ethanol causes DNA to precipitate into a “solid” strand. 8. Use the wooden splint to move around the DNA that is suspended in the ethanol.

Strawberry DNA Lab Safety: Be careful with glassware! Wear safety goggles. Disposal: Completely rinse glassware with water and place back in the plastic bins. Place plastic baggie, wooden splint & cheesecloth in trash can.

Strawberry DNA Lab Questions Why was the DNA extraction buffer used? What did the detergent in the extraction buffer do? What did the salt (NaCl) in the extraction buffer do? What did the ethanol do? Draw a diagram of DNA containing this sequence of nucleotide bases: ATCGAC Be sure to include: the sugar/phosphate backbone, the nucleotide bases, the covalent bonds, and the hydrogen bonds. PLEASE ANSWER ON YOUR OWN SHEET OF PAPER. QUESTION #5 IS WORTH THE MOST POINTS SO MAKE SURE YOUR DRAWING IS NEAT AND COMPLETE!