The Basics of Genetics
The Basics of Genetics Inside every cell of each living thing (plant or animal) are sets of instructions called genes. Genes provide the instructions on every feature of the organism: what it looks like how it is to behave how it will respond to its surrounding environment.
Most organisms have two pairs of chromosomes (one from each parent) The genes are made of long stands of material called deoxyribonucleic acid (DNA) and then many genes are strung together to form chromosomes. Most organisms have two pairs of chromosomes (one from each parent) However the total number of chromosomes can vary from organism to organism. For example, humans have 23 pairs of chromosomes and the fruit fly has 4 pairs.
Each gene is made up of long combinations of four different nucleotide bases. Like language, it is the number and order of the nucleotide bases that determine what the gene says about the organism. The four nucleotides are called: Adenosine (A) Thymine (T) Guanosine (G) Cytosine (C)
The gene for green eyes might have this nucleotide sequence. “AAACCGGTTTTTAACGTTATGGGCAAACGCGCGTTTAGTGAGACAAATTAACCGAGTTTAGATTCCCCAAATTGAGTTAACATGA” The gene for blue eyes might have this nucleotide sequence. “AAACCGGTTTTTAACGTTATGGGCAGACGCGCGTTTAGTGAGACAAATTAACCGAGTTTAGATTCCCCAAATTGAGTTAACATGA” Notice how the nucleotide sequences are very similar.
They both determine the eye colour characteristic, but the difference of only one nucleotide base results in a different colour. If you have a copy of both genes, how does the body determine which colour your eyes will be? Many genes have a quality known as dominance or recessiveness. Only the dominant gene will be expressed.