Long terminal repeats of porcine endogenous retroviruses in Sus scrofa

Slides:

Advertisements

Similar presentations

Molecular Genetics Introduction to The Structures of DNA and RNA

Advertisements

Identification of fusion transcripts with retroviral elements and its application as a cancer biomarker Yun-Ji Kim 1, Jae-Won Huh 2, Dae-Soo Kim 3, Hong-Seok.

How do you identify and clone a gene of interest? Shotgun approach? Is there a better way?

The Yeast nRNAP II Has 12 subunits, based on traditional enzyme purification and epitope tagging. Gene knockouts indicate that 10 subunits are essential,

Abstract The SFTPB (surfactant, pulmonary-associated protein B) gene on human chromosome 2p11.2 encodes an amphipathic surfactant protein essential for.

Alternative splicing and promoter of the GSDML gene implicated in the HERV-H LTR element Kung-Ahn, Jae-Won Huh, Dae-Soo Kim, Hong-Seok Ha, Yun-ji Kim,

Evolutionary diversification of DYX1C1 gene transcripts by HERV-H LTR integration event Results & Discussion Abstract DYX1C1 (dyslexia susceptibility 1.

Sergey G. Kurdyukov a, Yuri B. Lebedev a, Irena I. Artamonova a, Tatyana N. Gorodentseva a, a Anastasia V. Batrak a, Ilgar Z. Mamedov a, Tatyana L. Azhikina.

Molecular characterization of the DYX1C1 gene and its application as a colorectal cancer biomarker Yun-Ji Kim 1 *, Jae-Won Huh 1,2 *, Dae-Soo Kim 3, Min-In.

Quantitative analysis of various PCDH11 X/Y gene transcripts Kung Ahn 1, Jae-Won Huh 1, Dae-Soo Kim 2, and Heui-Soo Kim 1,2 1 Division of Biological Sciences,

LIPH gene (Lipase member H) located on human 3q27 is reported to be related to hair growth and loss by deletion mechanism of fourth exon. The deletion.

HA Hong-seok, HUH Jae-Won, KIM Dae-Soo 1, JOO Myung-Jin 2 and KIM Heui-Soo* Division of Biological Sciences, College of Natural Sciences, Pusan National.

Analysis of the atp9 5‘ trailer A B At5S-5 Atatp9.Endo.Mega.A atp9 At5S-Mega.R (-239) (-84/- 83) (+180) 5S rRNA 5’ 3’ atp9 mRNA atp9 pre-mRNA atp9 5’ leader.

AbstractIntroduction Materials & Methods Results & Discussion PCR Electrophoresis Gel purification Transformation1 Transformation2 Ligation Inoculation.

` Gene Diversification and Transcript Variants by Transposable Elements Un-Jong Jo 1, Dae-Soo Kim 1, Tae-Hyung Kim 1, Jae-Won Huh 2 and Heui-Soo Kim 1,2.

REFERENCES 1. J. Boeke, J. Stoye, Retrotransposons, endogenous retroviruses, and the evolution of retroelements, In Retroviruses (1997) 343– J.

Molecular characterization of the DYX1C1 gene and its application as a cancer biomarker Heui-Soo Kim 1, Yun-Ji Kim 1, Jae-Won Huh 1,2, Dae-Soo Kim 1,3,

ABSTRACT Isolation and phylogeny of endogenous retroviral elements belonging to the HERV-K LTR in cDNA library of human fetal brain and X q 21.3 region.

Molecular characterization of the DYX1C1 gene and its application as a cancer biomarker Yun-Ji Kim 1 *, Jae-Won Huh 1,2 *, Dae-Soo Kim 3, Min-In Bae 1,

Figure S1. RACE mapped transcription starts and polyA signals of Ogre CL5 and Ogre CL5del and putative splice site of Ogre CL5 and Ogre CL5del in Silene.

ABSTRACT INTRODUCTION REFERENCES MATERIALS & METHODS RESULTS & DISCUSSION Hong-Seok Ha 1, Jae-Won Huh 1, Dae-Soo Kim 2, Yun-Ji Kim 1, Ja-Rang Lee 1, Kung.

Relationship Between STAT3 Inhibition and the Presence of p53 on Cyclin D1 Gene Expression in Human Breast Cancer Cell Lines Introduction STAT3 and p53.

Materials & Methods References Introduction 1.Kim TH, Jeon YJ, Kim WY, Kim HS: HESAS: HERVs expression and structure analysis system. Bioinformatics 2005,

Supplemental Fig. S1 A B AtMYBS aa AtMYBS

Yu-Na Noh1, Jae-Won Huh1, Dae-Soo Kim2, Kung Ahn1, and Heui-Soo Kim1,2

Figure 1. RT–PCR identification of an abnormal transcript of the PTPN6 gene in normal and leukemic bone marrow cells and cell line. (a) Diagrammatic representation.

Molecular Evolution of PPHLN1 Gene in Relation to HERV-M Element

The Transcriptional Landscape of the Mammalian Genome

DNA Technology and Genomics

Supplemental Figure 2. (A) AtplaIVA-1 and AtplaIVA-2 null transcription lines for AtPLAIVA mRNA. RNAs from the relevant wild type Col were isolated.

Genome Information Laboratory

Gene-related Sequence

Different expression pattern between human and primate by integration of LTR33 element in MOBP gene Yu-Na Noh1, Jae-Won Huh2, Dae-Soo Kim3, Hong-Seok Ha1,

The impact of endogenous retrovirus (ERVs) in human genome

Pusan National University

GENOME INFORMATION LABORATORY

GENOME INFORMATION LABORATORY

In Silico Analysis of Transposable Elements Expression in Human Cancer

by Wen-feng Xu, Zhi-wei Xie, Dominic W. Chung, and Earl W. Davie

Volume 44, Issue 5, Pages (May 2006)

Functional Impact of Transposable Element using Bioinformatic Analysis

Transient Gene Expression by Nonintegrating Lentiviral Vectors

Sp1 Is Required for Glucose-Induced Transcriptional Regulation of Mouse Vesicular Glutamate Transporter 2 Gene Tao Li, Liqun Bai, Jing Li, Suzu Igarashi,

Testis Restricted Expression and Alternative Splicing of SVA-derived Transcripts of MRGPRX3 Gene Yu-Na Noh1, Jae-Won Huh2, Dae-Soo Kim3, Hong-Seok Ha1,

Volume 10, Issue 1, Pages (July 2004)

Testis Restricted Expression and Alternative Splicing of SVA-derived Transcripts of MRGPRX3 Gene Yu-Na Noh1, Jae-Won Huh2, Dae-Soo Kim3, Hong-Seok Ha1,

Molecular detection of SVA-derived transcripts

ALTERNATIVE TRANSCIPTION OF HUMAN

GENOME INFORMATION LABORATORY

Evolutionary dissection of ARMD event on LIPH gene

Expression of alternative transcription

Supplemental Figure 3 A B C T-DNA 1 2 RGLG1 2329bp 3 T-DNA 1 2 RGLG2

Molecular cloning of pms916 salt hypersensitive T-DNA mutant.

Comparative Transcription Promoter Activity

Yi-Deun Jung1, Jae-Won Huh1, Dae-Soo Kim2 and Heui-Soo Kim1, 2

Small Evolutionarily Conserved RNA, Resembling C/D Box Small Nucleolar RNA, Is Transcribed from PWCR1, a Novel Imprinted Gene in the Prader-Willi Deletion.

Hong-Seok Ha1, Jae-Won Huh1, Dae-Soo Kim2, and Heui-Soo Kim1 2

Bioinformatic Discovery of TransposableElements

Restriction Fragment Length Polymorphism (RFLP)

Association of the blaCMY-10 gene with a novel complex class 1 integron carrying an ISCR1 element in clinical isolates from Korea J.S. Song, S.J. Jang,

Assessing the Functional Characteristics of Synonymous and Nonsynonymous Mutation Candidates by Use of Large DNA Constructs A.M. Eeds, D. Mortlock, R.

Defining the Regulatory Elements in the Proximal Promoter of ΔNp63 in Keratinocytes: Potential Roles for Sp1/Sp3, NF-Y, and p63 Rose-Anne Romano, Barbara.

Promoting in Tandem: The Promoter for Telomere Transposon HeT-A and Implications for the Evolution of Retroviral LTRs O.N Danilevskaya, I.R Arkhipova,

Identification of TSIX, Encoding an RNA Antisense to Human XIST, Reveals Differences from its Murine Counterpart: Implications for X Inactivation Barbara.

IEG promoter-driven transgenic reporter system in the cricket brain.

Mutation of the Ca2+ Channel β Subunit Gene Cchb4 Is Associated with Ataxia and Seizures in the Lethargic (lh) Mouse Daniel L Burgess, Julie M Jones,

Structure of proviral PERV

Exon Skipping in IVD RNA Processing in Isovaleric Acidemia Caused by Point Mutations in the Coding Region of the IVD Gene Jerry Vockley, Peter K. Rogan,

Genome Information Lab

Abstract Results & Discussion Introduction Materials & Methods

Presentation transcript:

Long terminal repeats of porcine endogenous retroviruses in Sus scrofa Yun-Ji Kim1 Jae-Won Huh1, Byung-Wook Cho2, Dae-Soo Kim3, Hong-Seok Ha1, Ja-Rang Lee1, Kung Ahn1, and Heui-Soo Kim1,3 1 Division of Biological Sciences, College of Natural Sciences, Pusan National University, Busan 609-735, Republic of Korea 2 Department of Animal Science, College of Life Sciences, Pusan National University,Miryang 627-706, Republic of Korea 3 PBBRC, Interdisciplinary Research Program of Bioinformatics, College of Natural Sciences, Pusan National University, Busan 609-735, Republic of Korea http://www..primate.or.kr Abstract Introduction Materials & Methods Using PCR, sequencing, and bioinformatic approaches with the genomic DNAs of Korean pigs (domestic, wild, and hybrid with Yorkshire), twelve solitary PERV long terminal repeat elements were identified and analyzed. Structure analysis of the LTR elements indicated that they have different repeat sequences in the U3 region. The PERV-A6-KWP1 and –KWP2 elements bear seven and eight 39 bp repeats, respectively. The R region of the PERV LTR elements was highly conserved in pig and mouse genomes, suggesting that they seem to have originated from a common exogenous viral element, and then independently evolved throughout the course of mammalian evolution. Genomic DNAs & cDNA PCR & RT-PCR Bioinformatics KWP,KDP,KDP×KYP QIAEX II gel extraction kit(Qiagen) High Pure plasmid isolation kit BLAST,MEGA2 PCR Electrophoresis Gel purification Transformation1 Transformation2 Ligation Inoculation Plasmid DNA Isolation Gene Cloning Results & Discussion 4677-4698 5'-CATTTCTACTGAGCCACAACAG-3' PERV-X10-AS CT009542 3331-3352 1369 5'-CCTGAAAACTGCACTCTCCTCT-3' PERV-X10-S 30524-30544 5'-AGCAGGTTTAGGTTCACAGCA-3' PERV-X9-AS CT955978 31434-31453 930 5'-AGGAGTGGGTTCCAGGTTTC-3' PERV-X9-S 24380-24399 5'-CTTGCATACTTGGGCTTGTG-3' PERV-A8-AS CT827949 25321-25340 961 5'-GGAGGGTAGGACACAGTGGA-3' PERV-A8-S 17097-17116 5'-TGCTTTCACAAGTATTCATCCA-3' PERV-A7-AS CT797462 17981-18000 904 5'-CTCAGTGGGTTGGGGTTCT-3' PERV-A7-S 118450-118469 5'-CCCCAAATCACTCACGAGAA-3' PERV-A6-AS AC138167 117570-117589 899 5'-CGTATCCAATCACCTGCATC-3' PERV-A6-S 124785-124766 5'-TATTTCCATCCCTGAACCCA-3' PERV-A5-AS CT737311 125513-125494 748 5'-AAGCCAATCTCCCTTCTTCC-3' PERV-A5-S Acession no. Location PCR product size (bp) Sequences (5'-3') Primer Table 1. PCR primers used for amplification of PERV LTR element in Korean pigs (A) Conserved region PERV-A5 U3 R U5 Group1 Tandem repeated region PERV-A (Repbase) PERV-B PERV-A6 PERV-A7 (KYP, KDP, KWP) PERV-A8 LTR-IS Mouse S1 S5 S7 S2 S6 1 73 74 109 110 246 343 373 402 484 1 73 74 109 110 246 343 373 402 481 1 52 53 139 140 175 176 312 370 406 429 508 1 52 77 162 163 198 199 335 550 580 609 688 1 52 77 163 214 249 250 385 473 503 532 612 1 52 77 162 163 198 199 335 395 425 454 533 339 468 (KWP1) (KWP2) Group1a S3 1 52 53 139 140 175 176 312 409 439 468 547 1 52 77 162 163 198 199 335 628 658 687 766 1 52 77 162 163 198 199 335 667 697 726 805 Group2 PERV-X9 PERV-X10 S8 S9 1 52 53 90 91 131 132 215 218 253 254 402 481 501 512 541 620 1 52 53 90 91 131 132 215 239 274 275 423 502 522 533 562 641 Deleted region: GCCAGTAA S4 Fig. 1. Schematic representation of various PERV LTR elements (A) and consensus sequences of figured boxes (B). Open boxes indicate the conserved regions, and figured boxes indicate the specific sequences. Closed boxes indicate the different consensus sequences. Different boxes in tandem repeated region indicate the repeat number of tandem repeat sequences. Numbers indicate the specific position in individual LTR sequences. The underlined nucleotide sequences indicate the binding site for the transcription factor, NF-Y. The structures of solitary PERV LTR elements (PERV-A5, -A6, -A7, -A8, -X9, -X10) are derived from Korean pigs, KYP-hybrid of Korean domestic pig × Yorkshire, KDP-Korean domestic pig, and KWP-Korean wild pig (see also Table 2). KWP1 and KWP2 indicate the allele difference in the same individual. Group 2 is PERV-C LTR element and Group 1a is defined by the different copy number of tandem repeated sequences in our sequencing analysis. In the case of the mouse LTR-IS element, only the conserved region (open gray box) has high homology with PERV LTR elements...……………………………………………………………………. References Sus scrofa X10 CT009542 (722 bp) PERV-X10-GenBamk Hybrid (KDPⅹYorkshire) X9 AB275600 (701 bp) PERV-X9-KYP CT955978 (701 bp) PERV-X9-GenBamk Korean wild pig A8 AB275599 (609 bp) PERV-A8-KWP Korean domestic pig AB275598 (609 bp) PERV-A8-KDP AB275597 (609 bp) PERV-A8-KYP CT827949 (609 bp) PERV-A8-GenBamk A7 AB275596 (694 bp) PERV-A7-KWP AB275595 (694 bp) PERV-A7-KDP AB275594 (694 bp) PERV-A7-KYP CT797462 (694 bp) PERV-A7-GenBamk A6 AB275593 (794 bp) PERV-A6-KWP2 AB275592 (833 bp) PERV-A6-KWP1 AC138167 (762 bp) PERV-A6-GenBamk A5 AB275591 (628 bp) PERV-A5-KWP AB275590 (628 bp) PERV-A5-KDP AB275589 (628 bp) PERV-A5-KYP CT737311 (589 bp) PERV-A5-GenBamk Sources LTR Types Acession no. (LTR size) Clone Table 2. Clone information of PERV LTR elements in Korean pigs Denner J, Specke V, Thiesen U, Karlas A, Kurth R (2003) Genetic alteration of the long terminal repeat of an ecotropic porcine endogenous retrovirus during passage in human cells. Virology 314: 125-133. 2. Akiyoshi DE, Denaro M, Zhu S, Greenstein JL, Banerjee P, Fishman JA (1998) Identification of a full-length cDNA for an endogenous retrovirus of miniature swine. J Virol 72: 4503-4507. : GAGCCCTAACTCCAGCTTCCTAAA : CTCTGTATGAACTAGGTGAAAGGACGTAAAATAGGCCCTTGAATGCGTG : TGAGATAACAGGGAAAAGGGTT S1 : TATTTTAAAATGATTGGT (Original 18bp repeat) S5 : CCACGGAGCGCGGGCTCTCGA (Original 21bp repeat) S7 : TGTAGGAAAAATGATTGGT (Subtype of 18bp repeat) S3 : TGTTTTAAAACGATTGGT (Subtype of 18bp repeat) S2 : TGTTTTAAAATGATTGGT (Subtype of 18bp repeat) S6 : CCACGGAGCGCA (Subtype of 21bp repeat) S8 : AGTTTTGAATTGACTGGTTTGTGA (24bp, C type) S9 : TTGTAAAAGCGCGGGCTTG (19bp, C type) S4 : TTAAAATTAATTGGT (Subtype of 18bp repeat) : ATAAAA (TATA signal) : cap site (B) Genome Information Lab