Genetics and Biometrics

Genetic Definitions Locus Gene The position of a coding or non coding genetic element Gene All the nucleotide elements required for the expression of a transcript Promoter, ORF, introns, exons, etc.

Genetic Definitions (Cont’d) Allele Version of a genetic element at a given locus Everyone necessarily has two alleles for each genomic locus The two alleles may be the same Homozygotes The two alleles may be different Heterozygote A population of individuals may have multiple alleles of a genomic locus

Genetic Definitions (Cont’d) Genotype: Nucleic acid sequence responsable for the phenotype Physical detection by molecular techniques Phenotype: Trait that can be distinguished resulting from a genotype Several different genotypes may have the same phenotype

The Differences Between individuals of the same sex <0.5% Between humans and chimpanzes <2%

Molecular Markers Characteristics of the nucleotide sequence The phenotype often corressponds to a specific genotype Restriction polymorphisms (RFLP) Length polymorphisms (VNTR) Variable number of tandem repeats Single nucleotide polymorphisms (SNP)

Length Polymorphisms - RFLP Based on the presence or absence of a restriction site at a given poistion Ex. The enzyme EcoR1 recognizes and cleaves the sequence: GAATTC A mutation of a single base abolishes the site GAGTTC

Detection of Genomic RFLP Polymorphism 1 2 A B E A+B * E Genome 1 Genome 2 2 possible phenotypes 2 alleles can be distinguished Several possible genotypes

Detection of RFLP by PCR A B E A+B * Amplification & Gel Separation Genome 1 Genome 2 1 2 1 2 After digestion Before digestion

Length Polymorphisms Minisatellites and Microsatellites: Sequences repeated in tandem Highly variable number of repetitions between individuals; thus several alleles Length polymorphisms Molecular phenotype=Genotype   Minisatellites Low distribution throughout the genome Mostly found within telomeres Microsatellites: High distribution throughout the genome VNTR

VNTRs The number of repetitions = different lengths = different alleles = different genotypes = different molecular phénotypes

Length Polymorphisms of Microsatellites VNTR DNA Region where tandem copies of di-, tri- or tetra repeated units are located Examples: Dinucleotide repetitions GTGTGTGTGTGT…… Trinucléotide repetitions ACGACGACGACG…… Tetranucleotide repetitions TATCTATCTATC……

VNTR (Cont’d) Highly variable number of repetitions individuals Ex. Thus several alleles within a population Ex. CA Allele 1 Allele 2 Allele 3 Different fragment lengths would be generated by a digestion at the indicated positions

Detection of VNTR by PCR AGCTGCTTAATGCTGCTGCTGCTGCTGCTGCATAACATTGC Individual 1 AGCGGCTTAATGCTGCTGCATAACATTGC Individual 2 1 2 Amplification & gel separation

Biometrics

VNTR Profile of Nuclear Genome From whom does the blood come from?

VNTR Profile of Nuclear Genome Bob Luke Paul Tom Mark Who is Bob’s father?