Jeopardy Final Jeopardy $100 $100 $100 $100 $100 $200 $200 $200 $200

Slides:



Advertisements
Similar presentations
Let’s Play Scientists DNAReplication Transcription.
Advertisements

Chapter 12 Notes, DNA, RNA, and Protein Synthesis.
Chapter 10.  Explain the research of the following scientists:  Griffith: worked with pneumonia bacteria and mice to track how infection occurs. Results:
DNA Review!. Structure Scientists VocabProtein SynthesisRNA vs. DNA $100 $200 $300 $400 $500 FINAL JEOPARDY FINAL JEOPARDY.
1 2 Nucleic Acid History 3 Nucleic Acid Structure.
JeopardyNucleicAcidsDNAReplicationRNATranscriptionProteinTranslationEnzymes FINAL JEOPARDY
DNA Review!. Structure Scientists VocabProtein SynthesisRNA vs. DNA $100 $200 $300 $400 $500 FINAL JEOPARDY FINAL JEOPARDY.
DNA: The Genetic Material
DNA: Structure and Function. The DNA Revolution 1940s-1960s Griffith & Avery—DNA transformed pneumococcus bacteria. Encouraged the study of prokaryotic.
Molecular Genetics Section 1: DNA: The Genetic Material
Chapter 12 Notes, DNA, RNA, and Protein Synthesis
DNA Structure and Replication 8.2 and 8.3
Hereditary Material - DNA In 1952, Alfred Hershey and Martha Chase studied the genetic material of the virus called T2 that infects the bacterium E.Coli.
DNA Structure and DNA Replication How cells make a copy of their DNA before they divide.
DNA – The Genetic Material
DNA, RNA, Proteins Holt McDougal Biology
DNA: The Genetic Material Molecular Genetics Section 1 Griffith  Performed the first major experiment that led to the discovery of DNA as the genetic.
DNA, RNA, and Protein Synthesis
Biology Chapter 12.  Performed the first major experiment that led to the discovery of DNA as the genetic material Griffith.
Ch. 12. DNA: the genetic material  Griffith , used a bacteria that causes pneumonia to figure out that there are smooth (S) strains and rough (R)
DNA: The Genetic Material Molecular Genetics Section 1 Griffith  Performed the first major experiment that led to the discovery of DNA as the genetic.
DNA: The Genetic Material Chapter 12. Fredrick Griffith Performed the 1st major experiment that led to the discovery of DNA as actual genetic material.
Answers. 1. What were the names of the four scientists involved in proving DNA was the genetic material? Griffith, Avery, Hershey and Chase.
DNA Structure DNA: deoxyribose nucleic acid
CHAPTER 12 REVIEW !.
DNA (Deoxyribonucleic Acid)
Chapter 10 DNA, RNA, and Protein Synthesis
Nucleic Acids & Protein Synthesis
Life’s Instruction Manual or What Genes are Made Of
Lecture 50 – Lecture 51 DNA: The Genetic Material Ozgur Unal
DNA and Replication.
DNA song
Chapter 12 Molecular Genetics
Genetics.
Chapter 12 Section 1 DNA: The Genetic Material
Chapter 13 DNA Structure and Function
Chapter 12 Sections 1 and 2 only
Chapter 12 Sections 1 and 2 only
DNA and Protein Synthesis
DNA (Deoxyribonucleic Acid)
Genetics.
Nucleotide.
12.1 DNA.
Chapter 10 Table of Contents Section 1 Discovery of DNA
How is DNA duplicated in the Synthesis Stage?
What is DNA and how does it code for different traits?
WARM-UP #7.
Deoxyribonucleic Acid Chapter 12 Section 1
Jeopardy DNA to Protein
Life’s Instruction Manual or What Genes are Made Of
DNA: CH 13                .
WARM-UP #7.
WARM-UP #7.
History, Structure, Replication
DNA (Deoxyribonucleic Acid)
Molecular Genetics Glencoe Chapter 12.
AMAZING DNA FACTS… DNA from a single human cell extends in a single thread for almost 2 meters long!!! It contains information equal to some 600,000 printed.
Chapter 12 & 13 DNA and RNA.
WARM-UP #7.
Compare DNA and RNA in terms of structure, nucleotides and base pairs.
WARM-UP #7.
Chromosomes & DNA Replication
DNA and Replication.
Chapter 12: Molecular Genetics
Modern Genetics.
WARM-UP #7.
DNA Replication Chapter 12 Section 2
DNA, RNA, and Protein Synthesis
Presentation transcript:

Jeopardy Final Jeopardy $100 $100 $100 $100 $100 $200 $200 $200 $200 Dna Discovery Chromosome Structure Central Dogma DNA Structure DNA Replication $100 $100 $100 $100 $100 $200 $200 $200 $200 $200 $300 $300 $300 $300 $300 $400 $400 $400 $400 $400 $500 $500 $500 $500 $500 Final Jeopardy

1 - $100 What two scientists created a model of DNA? Watson and Crick

1 - $200 Who took the famous photo 51 using x-ray diffraction? Rosalind Franklin

1 - $300 Who identified the molecule that transformed the R strain of bacteria into the S strain? Oswald Avery

1 - $400 Who published results of experiments that provided definitive evidence that DNA was the transforming factor? Hershey and Chase

1 - $500 Who led the first major experiment that led to the discovery of DNA Frederick Griffith

2 - $100 What are the subunits of nucleic acids that consist of a 5 carbon sugar, a phosphate group, and a nitrogenous base. Nucleotides

2 - $200 In DNA the amount of cytosine is equal to the amount of______________ Guanine

2 - $300 In DNA the amount of adenine is equal to the amount of _______ Thymine

2 - $400 Thee twisted ladder shape of Dna is also called what? A double helix

2 - $500 Name the Pyrimidine bases Cytosine and thymine.

3 - $100 What type of replication saves half of the original DNA strand Semiconservative replication

3 - $200 What enzyme unwinds and unzips DNA DNA helicase

3 - $300 What enzyme adds nucleotides to the already existing ones DNA polymerase

3 - $400 Provide the complements to this DNA sequence ACGTACGATCCATGACAAGTCAGCAGGTACGATTTA TGCATGCTAGGTACTGTTCAGTCGTCCATGCTAAAT

3 - $500 What are okazaki fragments Answers may vary however the phrase lagging strand must be used

4 - $100 What is dna attracted to a histone called? Nucleosome

4 - $200 What do nucleosomes group up to form? Chromatin fibers

4 - $300 In prokaryotes, where is the DNA molecule contained? In the cytoplasm

4 - $400 What does DNA coil around. Histones

4 - $500 What kind of charge do the phosphate groups in DNA create Negative

5 - $100 What is the transfer of Dna to mRna Transcription

5 - $200 What is thymine replaced by in transcription Uracil

5 - $300 Which code is longer mRna or Dna Dna

5 - $400 Which is single stranded Dna or Rna RNA

5 - $500 Which rna trANSFERS THE AMINO ACIDS TO THE RIBOSOMES TRNA

Final Jeopardy Wha is 1=2 apoptosis