Basic Biology Review

Human Body Organization Levels 1. Chemical 2. Cellular 3. Tissue 4. Organ 5. Organ System 6. Organismic

Chemical Level Elements Molecules Compounds Macromolecules Ions H C O NaCl KCl Ions Na+ K+ Cl- Ca++ Mg++ Molecules O2 CO2 C6H12O6 Macromolecules Proteins amino acids Lipids fatty Acids Carbohydrates monosaccharides Nucleic Acids nucleotides

Cellular Level Chromatin

Tissue Level Epithelial Tissue Connective Tissue Muscular Tissue Nervous Tissue

Organ Level Gastrointestinal Tract 1. Mouth Accessory Structures 2. Pharynx 3. Esophagus 4. Stomach 5. Small Intestine 6. Large Intestine Accessory Structures 1. Teeth 2. Tongue 3. Salivary Glands 4. Liver 5. Gallbladder 6. Pancreas

Organ System Level

Organismic Level Darwin sails around the world and in South America is puzzled by the absence of rabbits. Instead he finds these rabbit-like Patagonian Hares or Mara (Dolichotis patagonum) that are not rabbits but have similar characteristics as rabbits. He postulates that they must have evolved just like rabbits because of their similar environments

Animal Cell Chromatin

DNA (deoxyribonucleic acid) Bases/Base Pairs Nucleotides 1. 2. 3. Nitrogenous Base Base Pairs: A – T C – G

DNA Organization Chromatin organized: DNA Histones One Duplicated Chromosome

Human Chromosomes A Pair of Duplicated Chromosomes Autosomes Sex Chromosomes 46 individual chromosomes / 23 pairs of chromosomes they are the same - code for same type of trait they are different - code for different version of trait

Understanding the Numbers 1 chromosome is 1 large DNA molecule a gene is a specific sequence of nucleotides ATTCCGTAGCTGATCGTAAAGGG 1000-2000 genes per chromosome ~25,000 - 30,000 genes per human genome

DNA Functions Pass on Genetic Material Replication Protein Synthesis Mitosis Meiosis Protein Synthesis Transcription Translation

Mitosis

Replication Making an exact copy of DNA Occurs just prior to cell division Double helix unwinds DNA polymerase adds bases Two exact copies are made

Embryongenesis - Week 1 Blastocyst Inner Cell Mass (Embryonic Stem Cells) Pluripotent Stem Cells

Embryogenesis Week 2 Embryonic Germ Cell Layers: Endoderm Mesoderm Ectoderm Multipotent Stem Cells

Cell Migration Growth Cone

Radial Glia Act like scaffolding to assist movement of neurons during development

Guide Posts Intermediate targets that help guide or direct the growth cone of the migrating cell in the proper direction

Chemotropism Target Cell or Tissue Target tissues or cells can release chemicals that will attract the specific growth cones of migrating cells.

Differentiation

Schizophrenia Abnormality Hippocampal Pyramidal Cell Disorganization

Neurobehavioral Hypothesis Maternal/Fetal Evidence: extensive maternal bleeding prolonged labor delivery complications low birth weight low head circumference body length:body weight multiparity Anectodal Evidence Dutch births during WWII Season of birth effect higher for winter pregnancies parallel with virus exposure

Protein Synthesis Transcription DNA to mRNA Translation mRNA to Protein

From Gene to Protein DNA RNA Protein

Genetic Code Codons three base code Code for specific amino acids

Point Mutation Spontaneous Mutation Environmental Insult Mutagenesis Carcinogenesis Mutation is corrected

Point Mutation Mutation is not corrected Mutation is corrected

Sickle-Cell Anemia Mutation

Sickle-Cell Anemia Mutation

Two-Hit Hypothesis Born with 2 genes or alleles for any given disease: one from mom one from dad If one is bad, this increases your chance of getting the disease

Cancer in Women

Lung Cancer