Darwin & Natural Selection Adapted from Mr. Gray & Bristol University

Basic Scientific Terms Review Hypothesis: is an educated guess, based on observations . It's a prediction of cause and effect. Theory: Summarizes a hypothesis/hypotheses Supported with repeated testing Valid as long as there is no evidence to dispute it Explains how and why something happens Example: Theory of Plate Tectonics Law: Generalizes a LOT of observations Tells you what IS going to happen Example: Law of Gravitation

Directions Manager: read ?’s Can a theory become a law? Explain. What’s wrong with this statement – I have a theory that students get more write ups after the holidays.

Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor. We can draw a “family” tree of life to show how every species is related.

Learning Manager – read ? Besides cell phones, what other non-biological items have evolved?

Charles Darwin Father of Evolution Proposed the theory of evolution, change over time Made observations on a 5-year trip around the world on the ship the HMS Beagle Wrote a book “Origin of the Species” that documented his observations Survival of the Fittest idea came from this book

Darwin’s Finches

Check out their feet!!!

On Task Manager – read ? Charles Darwin noticed all the different looks of the same species. How might different looks affect whether a species goes extinct?

Natural Selection Natural Selection: Organisms that are best adapted to an environment survive and reproduce more than others

How Natural Selection Occurs – 4 Ways Overproduction Variation Competition Selection

Overproduction Each species produces more offspring that can survive

Variation Each individual has a unique combination of inherited traits (DNA) Adaptation: an inherited trait that increases an organism’s chances of survival Environments can change which can change the success of an adaptation Same Parents

Adaptation Categories Camouflage (Blend in and hide) Mimicry (Act and look like) Physiological (Poison) Behavioral (Group behavior) Remember the organism doesn’t CHOOSE the adaptation! They are born with it or the environment is more supporting of it!

Coral Snake (Poisonous) Milk Snake (Not poisonous)

Stick Mantid

Flower Mantid

What adaptations do you see?

What adaptations do you see?

Variation The more variation within a species, the more likely they are to survive The more variation of types of species in a habitat, the more likely at least some will survive

Which community has a better chance of surviving a natural disaster? Community A Community B

Competition Individuals COMPETE for food, water, space, etc. Survival of the Fittest – the fittest is most able to survive and reproduce Not all individuals survive to adulthood

Selection Best adaptations will survive and be able to pass on their traits to their kids Genotype: your genes/DNA Ex: Cat’s ear shape Phenotype: your physical appearance that is influenced by your genes and the environment The color of the flamingo is based on what they eat (environment)

Materials Manager – read ? ‘s What are the 4 “methods” of natural selection? Which “method” in your opinion affects humans most?

How It Works Individuals with traits that are not well suited to their environment either die or leave few offspring. Evolution occurs when good traits build up in a population over many generations and bad traits are eliminated by the death of the individuals.

50 Million Years Ago

Today

Directions Manager – read ? Summarize how giraffes evolved.

Peppered Moth A Which moth will the bird catch? B

Evidence for Evolution: Fossil Record Homologous Body Structures Vestigial Organs Embryology Biochemical Evidence

Fossil Record Fossils provide a record of the history of life on Earth

Progression of Organisms http://en.wikipedia.org/wiki/Geologic_time_scale © World Health Org. en.wikipedia.org/wiki/Image:Eopraptor_sketch5.png © NASA origins bacteria complex cells dinosaurs humans The fossil record shows a sequence from simple bacteria to more complex organisms through time and provides the most compelling evidence for evolution.

Transitional Fossils – Ex. Archaeopteryx Missing link between reptiles and birds

Geologic Separation

Homologous Body Structures Body parts that are similar in different species Related organisms have similar body structures

Humans and Gorillas Bone Structure

Vestigial Organs “Leftover” organs (traces of evolution) that serve no purpose currently (did in the past) Examples appendix, tonsils, tailbone, wisdom teeth

Embryology Embryos of all vertebrates are very similar early on – yes you had gills!

The Pharyngeal Pouches will shape parts of the pharynx and upper bronchial segments

Biochemistry DNA with more similar sequences suggest species are more closely related Humans and chimpanzees share > 98% of identical DNA sequences HUMAN CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA CHIMPANZEE CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCATGACTGTTGAACGA GORILLA CCAAGGTCACAACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA Genetic code of chimps and gorillas is almost identical to humans

Directions Manager – read ? What are the 5 types of evidence used for evolution? What is your opinion about evolution?

Thinking outside biology/species – how might the quote above affect you in everyday/real life?

Supporting Resources Must Watch—Fantastic Review Simpson Evolution https://www.youtube.com/watch?v=0SCjhI86grU Must Watch—Fantastic Review https://www.youtube.com/watch?v=FW-uW71-DHU Simpson Evolution