Mutations. Mutations Mutation A permanent, heritable change in the DNA of an organism. One or several nucleotides can be added, deleted, or replaced.

Slides:



Advertisements
Similar presentations
Gene Mutations.
Advertisements

Section 1: Mutation and Genetic Change
DNA MUTATIONS.
Mutations.
What is a Mutation?. change in a DNA sequence that affects genetic information. Mutation:
8.7 – Mutations. Key Concept  Mutations are changes in DNA that may or may not affect phenotype. mutated base.
MUTATIONS SC STANDARD B-4.9: The student will exemplify ways in which new characteristics are introduced into an organism or a population.
Perubahan bahan genetik: Mutasi What is a Mutation? A mutation : a permanent change in the DNA sequence of a gene. Mutations in a gene's DNA sequence can.
Evidence for Evolution Area: Embryology Examples: embryo of pig and human Pro: best evidence because it is the most fundamental or basic information Vocabulary:embryo.
12.4 Mutations. Complete the 2 tables on the first page of your handout. Try this without using your notes first and only refer to your notes on transcription.
Mutations. Mutation  Permanent changes or errors in a DNA sequence  Copied during DNA replication  Therefore heritable  OR may occur during transcription.
GENE MUTATIONS.
Big Trouble in Small Packages MUTATIONS. What is a “mutation”? A permanent change in the genetic code. A “grey factor” mutantA “comic factor” mutant.
Mutations. What is a mutation? b Changes in the DNA sequence that affect genetic information Normal: Thesunwashotbuttheoldmandidnotgethishat. The sun.
Study the diagram below and be prepared to answer the following questions: What processes are represented by the 1, 2 and 3 in the diagram? What processes.
Genetic Mutations Good, bad or neutral?.
Chapter 14 Homework is due on Sunday, January 25 at 11:59 pm The Chapter 13 and 14 test is on Monday.
Mutations. A Mutation is a change in an organism’s DNA  It can occur naturally whenever a base is incorrectly copied, especially during DNA Replication.
Microbial Genetics - Mutation l Mutation - Introduction –A mutation is a change in the DNA sequence that results in a change in the product protein –Mutations.
8.7 Mutations TEKS 6E The student is expected to: 6E identify and illustrate changes in DNA and evaluate the significance of these changes.
Introduction A mutation is a change in the normal DNA sequence. They are usually neutral, having no effect on the fitness of the organism. Sometimes,
Mutations Introduction Every normal cell carries a full complement of genetic material A mutation can occur in: –a somatic (body) cell (aren’t passed.
MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.
8.7 Mutations A mutation is a change in an organism’s DNA. This may or may not affect phenotype.
Genes in ActionSection 1 Section 1: Mutation and Genetic Change Preview Bellringer Key Ideas Mutation: The Basis of Genetic Change Several Kinds of Mutations.
Mutation: The Source of Genetic Variation Chapter 11.
Fantasy Mutations Reality. Mutations: a permanent and heritable change in the nucleotide sequence of a gene. Are caused by mutagens (x-rays and UV light)
CHAPTER 14 SECTION 1 Mutations. Are mutations good or bad?  Some mutations lead to genetic disorders  Some mutations may cause a beneficial trait 
8.7 Mutations A mutation is a change in an organism’s DNA. May occur during replication. May affect a single gene, or an entire chromosome May or may not.
The Cell Cycle.
Section 1: Mutation and Genetic Change
Mutations 6/26/2018 SB2d.
Gene Mutations.
DNA MUTATIONS.
Gene Mutations.
Mutations.
11/29-Don’t Forget About Snork!!
Gene Mutations A change in the DNA of a gene is called a mutation. Mutations in gametes can be passed on to offspring of the affected individual,
DNA Mutations Biology 6(E).
Types of Mutations.
Mutations.
DNA and mutations SC.912.L.16.4.
Gene Mutations.
Gene Mutations Essential Question: How do changes in the DNA nucleotide sequence affect the resulting protein?
Menus Have you ever ordered something from a fast food restaurant and the order turned out to be incorrect? What lead to that error?
Mutations.
Mutations.
Types of point mutations
UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms?  Mutations -changes in a single base pair in DNA=changes in the nucleotide.
A mutation is a change in an organism’s DNA.
DNA MUTATIONS A mutation is a change in the DNA code.
Some mutations affect a single gene, while others affect an entire chromosome.
DNA and Mutations.
Mutations.
Section 1: Mutation and Genetic Change
Changes in the nucleotide sequence of DNA or mRNA
Turner College & Career High School  2016
A mutation is a change in an organism’s DNA.
DNA and Mutations.
Mutations.
What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?
Mutation Notes.
Mutations.
Copyright Pearson Prentice Hall
Gene Mutations A change in the DNA of a gene is called a mutation. Mutations in gametes can be passed on to offspring of the affected individual,
Protein Synthesis and Mutation
Mutations: Changes in Genes
Genetic Mutations.
Presentation transcript:

Mutations

Mutation A permanent, heritable change in the DNA of an organism. One or several nucleotides can be added, deleted, or replaced. Most mutations are neutral, many are harmful, some are lethal, and a few are beneficial.

Mutations Can Alter Phenotypes Mutations in genes can result in changes to the phenotype by altering the shape (and therefore the function) of the resulting protein.

What causes mutations? Mutations often happen when mistakes occur during replication. Also caused by mutagens like UV light, radiation, and certain chemical toxins.

How often do mutations happen? Mutations are rare events. The average rate of mutations is one in a million replications.

Are mutations always harmful? Most mutations produce no observable effect – they are “neutral.” Of those that have significant effect, most are harmful or lethal. Some mutations are beneficial. It all depends on the environment in which the mutation occurs. Examples: General & Humans

Types of mutations Point mutation: a different nucleotide replaces the original Missense: results in a single amino acid change (altered protein) Nonsense: results in a premature stop codon (shortened protein) Silent: results in the same amino acid (unaltered protein)

Missense Mutation

Nonsense Mutation

Silent Mutation

Types of mutations Frameshift mutation: a deletion or insertion that alters the "reading frame" causing the codons that follow it to be changed

Normal Protein → Normal Function A A U|U A C|U G C|U C U|G G A|G A G|U G U|G A A|U U U|G U G Asn Tyr Cys Ser Gly Glu Cys Glu Phe Val Normal Protein → Normal Function A A U|U A C|U G C|U C U|G G A|G A G|U G A|A U U|U G U|G U U A A U|U A C|U G C|U C U|G G A|G A G|U G A|A U U|U G U|G U U U|G A A|U U U|G U G U U Asn Tyr Cys Ser Gly Glu Shorter Protein → Loss of Function

(A) Dogs have two copies of the wild-type allele (+/+). (B) Dogs are heterozygous with one wild-type allele and one mutant cys → stop allele (mh/+). (C) Dogs are homozygous for the mutant allele with two copies of the cys → stop mutation (mh/mh).

Are you a mutant? A. Yes B. No Scientists estimate about 1-6 point non-silent mutations in coding DNA per individual. The total number of point mutations per individual is much higher, but almost all of these are either silent or are in non-coding DNA. These are the mutations you inherited from your parents. However, since DNA replication takes place in your body so many times during your lifetime, many of your cells likely contain mutations. A. Yes B. No

What is a Mutation?

Mutate a Sentence! We can think about DNA gene sequence as a sentence made up entirely of three-letter words. In the DNA sequence, each three-letter word is a "codon," specifying a single amino acid in a protein.

Mutate a Sentence! Have a look at this "sentence": thesunwashotbuttheoldmandidnotgethishat If we were to split this sentence into individual three-letter words, we would read it like this: The sun was hot but the old man did not get his hat

Mutate a Sentence! The sentence represents a gene. Each letter corresponds to a nucleotide, and each word represents a codon. Only one of the three possible "reading frames" translates into an understandable sentence. In the same way, only one three-letter "reading frame" within a gene codes for the correct protein.

Mutate a Sentence! What if you shifted the three-letter "reading frame?“ In the space below, show how you can change the "reading frame" of the above sentence by inserting or deleting letters within the sentence. The result should be a "nonsense" sentence.

Mutate a Sentence! X The sun was hot but the old man did not get his hat hes unw ash otb utt heo ldm and idn otg eth ish at

Mutate a Sentence! Now make a mutation that maintains or changes the meaning of the sentence without creating such nonsense. The sun was hot but the old man did not get his hat The sun was hot but the old man did get his hat The sun was hot but the old man did not eat his hat The sun was not hot but the old man did get his hat