Genes, traits, and morphs

Genotype Phenotype (trait) https://www.ncbi.nlm.nih.gov/nuccore www.pnas.org#cgi#doi#10.1073#pnas.0711034105

From gene to phenotype DNA Covered barley: Lemma and palea adhere to seed RNA Other genes Pathways Environmental signals Protein

The locus, a gene, and alleles The nud locus: Location of the nud gene, on barley chromosome 7H. Alleles at this locus include Nud and nud. The Nud allele is functional and the naturally-occurring nud allele is due to loss of function (a 17 kb deletion of DNA, including the nud gene).

The locus, a gene and alleles Allelic state Phenotype Covered Naked N N Homozygous dominant Covered is dominant to naked The dominant allele is functional The recessive allele is due to loss of function N n Heterozygous n n Homozygous recessive

DNA Five carbon sugar – deoxyribose Phosphate group One of four bases Purines Five carbon sugar – deoxyribose Phosphate group One of four bases Pyrmidines http://users.rcn.com/jkimball.ma.ultranet/BiologyPages/N/Nucleotides.html

Nucleotide + Nucleotide + Nucleotide + …… DNA: Polymerization Nucleotide + Nucleotide + Nucleotide + …… http://users.rcn.com/jkimball.ma.ultranet/BiologyPages/N/Nucleotides.html

Transcription mRNA (substitute u for t) DNA join(1..83,284..884)

Translation mRNA (substitute u for t) Protein

Plant Gene Structure

From protein to phenotype Covered barley: Lemma and palea adhere to seed Other genes Pathways Environment signals Protein

ERF Transcription Factor Transcription factors General: Required for transcription. Regulatory: Bind to specific DNA sequences and regulate the expression of those sequences (genes). Can activate or repress. ERF = Ethylene responsive factor Xu et al. 2011. Functions and Application of the AP2/ERF Transcription Factor Family in Crop Improvement. http://onlinelibrary.wiley.com/doi/10.1111/j.1744-7909.2011.01062.x/full#f1

The Nud ERF transcription factor Regulates an unknown gene (genes) involved in a pathway leading to synthesis of a lipid gum that causes the lemma and palea to adhere to the seed. Other genes (lipid biosynthesis) Environmental signals Protein

Monomorphism Genetically the same, generation after generation (unless……) Phenotypically the same, generation after generation (unless……)

Monomorphism to …........polymorphism Genetically the same, generation after generation, until a change in sequence Phenotypically the same, generation after generation, until a change in sequence leads to a change in the trait

Phenotypic polymorphisms Due to mutations Naked Eye Polymorphism (NEP)

Genotypic polymorphisms Due to mutations Addition, subtraction, or substitution of DNA sequence

Polymorphisms Genotypic Types Insertion/ Deletion (InDel) Single nucleotide substitution (SNP) -------------------------------------------------------------- (17kb) Or

Polymorphisms Genotypic Wild type Effect on phenotype Causal Mutant -------------------------------------------------------------------------------------------------- (17kb)

Polymorphisms Genotypic Wild type Effect on phenotype Neutral Mutant

The source of polymorphisms Mutation The source of polymorphisms Naturally occurring Random Rare Usually deleterious The source of genetic variation Caused by errors in DNA replication DNA repair Naturally occurring color variant in hops. Shaun Townsend, OSU

The source of polymorphisms and the beginning of deliciousness… Mutation The source of polymorphisms and the beginning of deliciousness… Naturally occurring Random Rare Usually deleterious The source of genetic variation Caused by errors in DNA replication DNA repair Delicious Red Delicious Fuji

The source of polymorphisms Mutation The source of polymorphisms Induced Ionizing radiation (e.g. gamma rays) Random BUT can target specific types of changes (e.g. deletions) Rare BUT can manipulate frequency Usually deleterious A potential source of genetic variation Caused by errors in DNA replication DNA repair Gamma ray induced sexual variant in hops. Shaun Townsend, OSU

The source of polymorphisms Mutation The source of polymorphisms Induced Chemicals (e.g. ethyl methanesulfonate (EMS)) Random BUT can target specific types of changes, e.g. G:C to A:T Rare BUT can manipulate frequency (e.g. dosage) Usually deleterious A potential source of genetic variation Caused by errors in DNA replication DNA repair

The source of polymorphisms Mutation The source of polymorphisms Caused by errors in DNA replication https://evolution.berkeley.edu/evolibrary/article/evo_20

The source of polymorphisms Mutation The source of polymorphisms Caused by errors in DNA repair in response to errors during replication DNA damage by mutagens https://www.ncbi.nlm.nih.gov/books/NBK21114/#A8425

Mutations result from heritable changes in DNA sequence May affect transcription, translation, and phenotype An insertion/deletion event can produce a frameshift *** CTG GGA GAT TAT GGC TTT AAG *** CTG GGA TAA G codon alignment Leu Gly Asp Tyr Gly Phe Lys Leu Gly STOP G translation *** CTGGGAGATTATGGCTTTAAG*** *** CTGGGA - - - - - - - - - - -TAAG*** 11 bp deletion, alignment

Mutations result from heritable changes in DNA sequence May affect transcription, translation, and phenotype Single nucleotide substitutions can have different consequences on phenotype Silent *** CTG GGA GAT TAT GGC TTT AAG*** *** CTG GGA GAT TAT GGC TTC AAG*** alignment Leu Gly Asp Tyr Gly Phe Lys Leu Gly Asp Tyr Gly Phe Lys translation Missense *** CTG GGA GAT TAT GGC TAT AAG*** alignment Leu Gly Asp Tyr Gly Tyr Lys translation Nonsense *** CTG GGA GAT TAG GGC TTT AAG*** alignment Leu Gly Asp Tyr Gly Phe Lys Leu Gly Asp STOP translation

Mutations result from heritable changes in DNA sequence May affect transcription, translation, and phenotype https://ghr.nlm.nih.gov/primer/mutationsanddisorders/possiblemutations

Targeted mutations result from heritable changes in DNA sequence May affect transcription, or translation, phenotype (target), or phenotypes (non-target)

The source of polymorphisms Mutation The source of polymorphisms CRISPR-Cas gene editing Target specific DNA sequences “Knock out” Change in function due to addition/deletion/change in sequence A powerful source of genetic variation

Mutation CRISPR Clustered regularly interspaced palindromic repeats The tools Target sequence Cas enzymes (CRISPR-associated nucleases; (e.g. Cas9) gRNA (Guide RNA) https://www.ncbi.nlm.nih.gov/pubmed/27252719

Mutation CRISPR A powerful source of genetic variation Parthenocarpic (seedless) tomato Parthenocarpy – production of seedless fruits without fertilization Auxin-mediated Targeted genes associated with auxin signaling High mutation rate No off-target mutations https://www.nature.com/articles/s41598-017-00501-4

Genes, traits, and morphs