DNA Deoxyribonucleic Acid The Blueprint of Life Biology I Searcy Ninth Grade Center

Where have scientists been? A brief history Oswald Avery (1944) Discovered that the nucleic acid DNA stores and transmits the genetic information from one generation of an organism to the next Where have scientists been? A brief history Canadian biologist

Alfred Hershey & Martha Chase (1952) Concluded that the genetic material of the bacteriophage was DNA, not protein. Used radioactive phosphorous and sulfur. American scientists Why they used these radioactive makers?

Erwin Chargaff (1950) Discovered a relationship in the nitrogenous bases Adenine (A) = Thymine (T) Guanine (G) = Cytosine (C) American biochemist Paired with

Rosalind Franklin (1952) Took an x-ray of the DNA structure so the patterns could be seen. The x-rays show that DNA is twisted around each other like a helix and has two strands. British scientist in the early 1950’s used x-ray diffraction to get info. About the structure of DNA by recording the scattering patterns of the x-ray on film (b/c she was a woman, she did not receive recognition for her contribution until about 10 yrs. ago)

James Watson & Francis Crick (1953) Studied the structure of DNA by building a 3-dimentional model of the molecule after using clues from Franklin’s x-ray of DNA. Watson-American biologists Crick-British physicist

Watson-American biologists Crick-British physicist Watson and Crick proposed that DNA is made up of 2 chains of nucleotides held together by nitrogenous bases & that the 2 strands are twisted together in a shape called a double helix.

DNA is a polymer made up of repeating monomers of nucleotides. DNA determines an organism’s traits by controlling the manufacturing of proteins. The sequencing of nucleotides forms unique genetic information. The Structure of DNA

The nucleus of a cell contains chromosomes

Which are made up of coiled DNA

Eukaryotic chromosomes contain DNA wrapped around proteins called Histones. Solenoid Histone Proteins DNA Double Helix

Each strand of DNA is made up of subunits called Nucleotides

Each nucleotide is constructed of 3 parts: a PHOSPHATE group, A SUGAR molecule & 1 of 4 nitrogen bases Why DNA is often compared to a ladder? DNA is similar to a ladder: the rails of a ladder represent the sugar-phosphate backbone of DNA, and the rungs of a ladder represent the nitrogen base. How is a ladder different from DNA? DNA is twisted while a ladder is flat and that a “rung” in the DNA molecule is made of two bases, while the ladder’s rung is a single unit. The P of one nucleotide is bonded to the sugar of another nucleotide. Adenine (A) Guanine (G) Cytosine (C) Thymine (T) Purines Pyrimidines

Because of the hydrogen bonds, Adenine can only bond with Thymine & Guanine can only bond with Cytosine *A purine is always paired with a pyrimidine. Adenine Thymine Guanine Cytosine

This is known as COMPLEMENTARY base pairing

CCA GAT TGA GGT CTA ACT For example: Now you try: GCA ATC TA CGT TAG AT Now you try: CCA GAT TGA GGT CTA ACT

Mini Quiz What 2 scientists constructed a model of DNA and published their results in 1953? If one strand of DNA read ATC GTA, what would the other strand read?

DNA Replication

DNA Replication Copying process by which a cell duplicates its DNA DNA molecule separates into two strands, then produces two new complementary strands following the rules of base pairing Each strand of the double helix of DNA serves as a template for the new strand DNA Replication

How Replication Occurs Enzymes unzip DNA by breaking the hydrogen bonds between the base pairs, which produces two replication forks DNA polymerase Joins individual nucleotides to make a new strand Proofreads each new strand How Replication Occurs

RNA & Protein Synthesis DNA remains in the nucleus, but in order for it to get its instructions translated into proteins, it must send its message to the ribosomes where proteins are made. The chemical used to carry this message is Messenger RNA. RNA & Protein Synthesis

RNA: Ribonucleic Acid 3 Types of RNA: mRNA=Messenger RNA: FX: Carry the genetic information out of the nucleus for protein synthesis tRNA=transfer RNA: FX: decode the information by transferring the amino acid to the ribosome as it is specified by coded messages in mRNA rRNA=Ribosomal RNA: constitutes 50% of a ribosome, which is the site of protein synthesis.

RNA is Similar to DNA Except Has one strand instead of two strands. Has uracil instead of thymine. Has ribose instead of deoxyribose.

mRNA has the job of taking the message from the DNA to the nucleus to the ribosomes. Transcription - RNA is made from DNA Translation - Proteins are made from the message on the RNA

How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA Ribosome AUGCGUGUAAAUGCAUGCGCC mRNA ? MetArgValAsnAlaCysAla Protein aa How can you code for 20 amino acids with only 4 DNA bases (A,U,G,C)?

mRNA Codes for Proteins in Triplets TACGCACATTTACGTACGCGG DNA Ribosome Codon AUGCGUGUAAAUGCAUGCGCC mRNA MetArgValAsnAlaCysAla Protein Codon = block of 3 mRNA bases

The mRNA Code For ALL life! Code has duplicates Start Codon strongest support for a common origin for all life Code has duplicates several codons for each amino acid mutation insurance! Start Codon AUG methionine Stop Codons UGA, UAA, UAG Strong evidence for a single origin in evolutionary theory.

mRNA to protein = Translation The working instructions  mRNA The reader  ribosome The transporter  transfer RNA (tRNA) Ribosome mRNA U C A G aa tRNA G U aa tRNA U A C aa tRNA G A C tRNA aa A G U

From Gene to Protein DNA mRNA Protein Trait tRNA Nucleus Cytoplasm aa Transcription Translation DNA mRNA Protein Ribosome U C A G tRNA aa Trait Cytoplasm

Nucleus Cytoplasm Protein Transcription Translation Trait

Transcription Translation Protein