Biotechnology Notes Chapter 9

Biotechnology Scientist change an organism’s DNA to give it new traits. Possible because all organisms have the same Genetic Code

What are the benefits? Insert needed gene into an organism Make better vegetables/fruits Identify suspects Increase biodiversity

Restriction Enzymes “Cuts” DNA Act like molecular “scissors” Lets scientist take out and insert a new gene

Restriction Enzymes What are they? protein Cuts DNA into smaller pieces (molecular scissors) certain enzymes recognize specific sequences of DNA nucleotides

Restriction Enzyme Different restriction enzymes cut in different places They recognize nucleotides between 4 and 8 bases long

Where does the EcoRI cut? GCTATAGGAATTCATACCGCCGTAATAGCGAATTC CGATATCCTTAAGTATGGCGGCATTATCGCTTAAG The restriction enzyme produces 3 fragments

Restriction Enzymes Some cut straight and make “blunt ends” Some cut staggered and make “sticky ends”

Restriction enzymes can make two types of cut sites 1. Sticky has overhang (genetic engineering) -G AATTC- -CTTAA G- a. easily bind to complementary strands in DNA from other organisms b. isolate a gene and put into another strand of DNA (gene cloning) 2. Blunt (DNA fingerprinting and sequencing) -CCC CCC- -GGG GGG-

Gel electrophoresis Uses an electrical current to separate DNA sequences that were cut by restriction enzymes.

Gel electrophoresis Electrical currents pull the pieces through a gel Smaller fragments can move faster & farther than longer fragments

Gel electrophoresis Each piece creates a band on the gel Creates a DNA fingerprint Everyone has their own unique DNA fingerprint

DNA Fingerprinting Made by restriction enzymes and gel electrophoresis What is it used for? Paternity tests Evidence in criminal cases Studying biodiversity (mother) (child 1) (child 2) (father)

http://player. discoveryeducation. com/index. cfm http://player.discoveryeducation.com/index.cfm?guidAssetId=DD31D995-3E35-4858-8E2C-0E6045BEDBA6&blnFromSearch=1&productcode=US#

Genetic Engineering Restriction enzymes cut out a specific gene Gene is inserted into new organism

Plasmid loops of DNA in bacteria restriction enzymes cut plasmid and foreign DNA foreign gene inserted into plasmid Contains genes not important for survival -can be transferred from one bacteria to another

Recombinant DNA Contains genes from more than one organism (bacterial DNA)

Transgenic Organism Has one or more genes inserted in it’s DNA  Has recombinant DNA

Transgenic Organism Transgenic bacteria used to make human protein Gene inserted into plasmid Plasmid inserted into bacteria Bacteria makes the protein the gene coded for

Uses of Transgenic Organisms Transgenic plants used in agriculture Creates crops resistant to frost, diseases, and insects Food produced more quickly and cheaply

Uses of Transgenic Organism Bacteria with human DNA make human proteins Ex. Insulin Cows inserted with genes that produce more milk or human protein-enriched milk

Concerns about Genetic Engineering possible long-term health effects of eating GM foods possible effects of GM (genetically modified) plants on ecosystems and biodiversity

List Genetically Modified Fruit Papaya-Virus resistant Pluot-plum and apricot

Anti-freeze gene in fish inserted in tomatoes and strawberries

Corn with vaccines Ex. Hep A

Class work Genetic Engineer Fruit 1. Vocabulary Chart Homework