Central Dogma
Introns and exons The DNA is first transcribed into pre-mRNA (which includes both introns and exons) Introns – non-coding regions of a gene (junk DNA) Exons – part of a gene that codes for amino acids Mature mRNA has had the introns removed, leaving only the ______. exons
Translation process of converting information in nucleic acid sequences into proteins
Information stored in the _______ is transferred out of the nucleus using ______ and taken to the _________ where proteins are made. AAUGGCUGUAUU Every 3 bases is called a codon (think code) How many codons are shown above? DNA mRNA Ribosome 4
Gene - a sequence of bases that codes for a specific protein. 20 different amino acids
2nd letter of codon stop stop stop 3rd letter of codon 1st letter of codon
Stop codons = UAA, UGA, UAG Start codon = AUG Translation always starts at this codon Stop codons = UAA, UGA, UAG Translation stops when ribosome comes across stop codon A protein is a string of amino acids connected
Translate the mRNA sequence below: AAGAUGUUUGCGCUGCGAUAGCCC Don’t forget your start and stop codons!
Translation animation: http://www-class.unl.edu/biochem/gp2/m_biology/animation/gene/gene_a3.html