BPTF role in PI3K-AKT pathway in breast cancer

Slides:

Advertisements

Similar presentations

p53 Revealed character as a tumor suppressor gene in 1989.

Advertisements

Cancer: a genetic disease of inherited and somatic mutations n Gene mutations and/or genetic instability are involved in many cancers. n Viruses and environmental.

BRCA1 The First Breast Cancer Gene Presentation By Liz Mosley.

When mammalian cells are subjected to stress signals, oxygen deficiency, radiation, DNA damage, or Chemo- therapeutic drugs, p53 is activated, leading.

Tumorigenesis to Cancer Development Pin Ling ( 凌斌 ), Ph.D. ext 5632; References: 1.Chapter 23 Cancer in “Molecular Cell Biology”

Apoptosis (Programmed Cell Death). Apoptosis vs Necrosis Level of stress, change in environment stress apoptosisnecrosis.

LEANNA BROOKS BRG1: LUNG CANCER. LUNG CANCER WHAT DOES THIS HAVE TO DO WITH BRG1? LOH in chromosome 19 is frequent in NSLC tumors BRG1 is very frequently.

“CRISPR genome editing” Precise gene regulation/modification using the simple CRISPR/Cas9 system Thank you. Nucleeases will be used as a new tool that.

CDCA7 A case study in cellular regulation

The Cell Cycle and Cancer AP Biology. Cell Cycle Numerous genes control the cell cycle They regulate the progression through checkpoints. A sensor detects.

Telomerase, Immortalization and Cancer Eric Bankaitis Cancer Bio 169 March 9, 2006 Fig.[9]

Homework #3 is due 11/15 Bonus #2 is posted No class on 11/20.

Types of Genes Associated with Cancer

BLOOM HELICASE (and BLOOM SYNDROME)

Tumor-suppressor genes Tumor-suppressor genes, function like brakes, keep cell numbers down, either by inhibiting progress through.

Xiaole Shirley Liu STAT115, STAT215, BIO298, BIST520

GENETICS A Conceptual Approach

GENETICS A Conceptual Approach

Leila Kokabee*, Xianhui Wang, Cheryl Eifert, Douglas S. Conklin

Cell Physiol Biochem 2017;42:2582– DOI: /

a research proposal by gus thomas

Mouse Double Minute 2 (MDM2)

Cancer – a disease of many mutations

Use of CRISPR/Cas to edit the Arabidopsis Na+/H+ Antiporter NHX1

Institute of Health and Biomedical Innovation

GENETIC BASIS OF CANCER

Abstract PI3K–Akt signaling is critical for the development, progression, and metastasis of malignant tumors, but its role in the tumor microenvironment.

Loyola Marymount University

Epigenetic modulators, modifiers and mediators

Effect of microRNA-135a on Cell Proliferation, Migration, Invasion, Apoptosis and Tumor Angiogenesis Through the IGF-1/PI3K/Akt Signaling Pathway in Non-Small.

The Long Non-Coding RNA XIST Interacted with MiR-124 to Modulate Bladder Cancer Growth, Invasion and Migration by Targeting Androgen Receptor (AR) Cell.

The Genetic Basis of Cancer

Cell Physiol Biochem 2017;44:1867– DOI: /

The Role of SMAD4 (DPC4) in Cancer

breast cancer 2, early onsetpro What does this protein make up or do?

Volume 144, Issue 3, Pages e4 (March 2013)

What makes a mutant?.

Endoplasmic Reticulum Stress Promotes Autophagy and Apoptosis and Reduces Chemotherapy Resistance in Mutant p53 Lung Cancer Cells Cell Physiol Biochem.

Epidermal Growth Factor Promotes Proliferation and Migration of Follicular Outer Root Sheath Cells via Wnt/β-Catenin Signaling Cell Physiol Biochem 2016;39:

Concept 18.5: Cancer results from genetic changes that affect cell cycle control The gene regulation systems that go wrong during cancer are the very same.

Dieter Steinmetz Universität Tübingen – ZMBP Kurs WS 15/16

Figure 2 Signalling pathways and physiological domains that are

B lymphocytes produce antibodies.

PTEN (a.k.a. MMAC1 and TEP1) and Cowden’s Disease

BPTF role in PI3K-AKT pathway in breast cancer

Cancer stem cells and their application into targeted therapy for cancer Mol. Bio. Lab Park Ji Won Supervisor ; Dae Youn Hwang.

Figure 1 A schematic representation of the HER2 signalling pathway

Regulation of Gene Expression

PTEN Tumor Suppressor and Cancer

Bcl-2: A Matter of Life-or-Death

FANCF methylation contributes to chemoselectivity in ovarian cancer

Genome editing by CRISPR

Uc.454 Inhibited Growth by Targeting Heat Shock Protein Family A Member 12B in Non- Small-Cell Lung Cancer Jun Zhou, Chenghai Wang, Weijuan Gong, Yandan.

Bo-Kuan Wu, Charles Brenner Cell Reports

CRISPR/Cas9: A Potential Life-Saving Tool. What’s next?

Shrimp miR-34 from Shrimp Stress Response to Virus Infection Suppresses Tumorigenesis of Breast Cancer Yalei Cui, Xiaoyuan Yang, Xiaobo Zhang Molecular.

Specific Tumor Suppressor Genes

Selective Transcription in Response to an Inflammatory Stimulus

MiR-200c is a PI3K–AKT signaling pathway regulator in CRC

Expression of versican promoted breast cancer cell self-renewal through enhanced EGFR/AKT/GSK-3β (S9P) signals. Expression of versican promoted breast.

Overexpression of EP4 with cAMP-PKA signal activation promoted the castration-resistant progression of LNCaP cells through AR activation. Overexpression.

The Aging Epigenome Molecular Cell

Met is expressed in Her2-overexpressing cell lines and Her2 (+) breast tumors. Met is expressed in Her2-overexpressing cell lines and Her2 (+) breast tumors.

Transcriptional activity and growth of mutant ER in a breast cancer cell line. Transcriptional activity and growth of mutant ER in a breast cancer cell.

HOXA11-AS acts as a ceRNA for miR-1297.

Identification of RASA1- and NF1-mutated lung cancer cell lines in the CCLE dataset (accessed via the cBioPortal for Cancer Genomics at

mRNA expression of PARP1 in SCLC cell lines and solid tumors.

Presentation transcript:

BPTF role in PI3K-AKT pathway in breast cancer Michael Livingston

40,000 people per year

What is Cancer? Normal cells acquiring tumor promoting traits uncontrolled cell growth avoiding detection by the immune system overriding DNA damage checkpoints Dysregulated Gene Expression Nucleosome Remodeling complexes ATP-dependent

Nucleosome Remodeling Factor (NURF) Largest subunit: Bromodomain PHD finger transcription factor (BPTF) Functional role in tumor progression is incompletely understood Part of the ISWI family

PI3K-AKT Pathway Regulates many normal cellular processes proliferation, survival, and growth. Processes that are critical for tumor growth

Experiment Overview CRISPR/Cas9 knockout BPTF gene Overexpress BPTF Transfect cell lines Western Blot Will knockout of BPTF decrease expression of proteins related to PI3K-AKT pathway in breast cancer cell lines?

CRISPR/Cas9 Used to knockout BPTF gene “AGAGGAGGACATGGTCTCCGAGG” Target sequence: Used to knockout BPTF gene

Generate recombinant adenoviruses via Co-transfection Screen E.coli -Recombinants are white -Non-recombinants are blue Co-Electroporate vectors into E.coli Adenoviral backbone vector

Transfect Cell Lines

Western Blot Secondary Detection

Previous Study’s Results Dai et al (2015) examined the effects of BPTF on lung cancer cell lines Reported that BPTF regulates PI3K-AKT signaling pathway in lung cancer (Fig). Will knockout of BPTF decrease expression of proteins related to PI3K-AKT pathway in breast cancer cell lines?

Questions or Comments

References Tessa G. Montague; Jose M. Cruz; James A. Gagnon; George M. Church; Eivind Valen. (2014). CHOPCHOP: a CRISPR/Cas9 and TALEN web tool for genome editing. Nucleic Acids Res. 42. W401-W407 "GeneArt CRISPR Products and Services." Thermo Fisher Scientific. N.p., n.d. Web. 30 Apr. 2016. Luo, Ji, Brendan D. Manning, and Lewis C. Cantley. "Targeting the PI3K-Akt pathway in human cancer: rationale and promise." Cancer cell 4.4 (2003): 257-262. Vos, Pieter, et al. "AFLP: a new technique for DNA fingerprinting." Nucleic acids research 23.21 (1995): 4407-4414. Liu, B., Yip, R. K., & Zhou, Z. (2012). Chromatin Remodeling, DNA Damage Repair and Aging. Current Genomics, 13(7), 533–547. http://doi.org/10.2174/138920212803251373 Raab, J. R., Resnick, S., & Magnuson, T. (2015). Genome-Wide Transcriptional Regulation Mediated by Biochemically Distinct SWI/SNF Complexes. PLoS Genet, 11(12), e1005748. -Kim, K. H., Kim, W., Howard, T. P., Vazquez, F., Tsherniak, A., Wu, J. N., ... & Orkin, S. H. (2015). SWI/SNF-mutant cancers depend on catalytic and non-catalytic activity of EZH2. Nature medicine, 21(12), 1491-1496. https://upload.wikimedia.org/wikipedia/commons/3/3d/Gene_therapy.jpg