Mystery of the Matching Marks part 2

Let’s look at our two sets of chromosomes again, side-by-side. This time, Focus on their DIFFERENCES: What do you see in the chimp chromosomes (on the right) that is DIFFERENT from the human chromosomes (on the left)?

How are they different?

What could have happened to cause those differences? GOOD EYES! - Chimp’s #2 is shorter than our #2 -Chimp has an extra unmatched chromosome What could have happened to cause those differences? Let’s take a closer look at those chromosomes…

“Missing” part “Extra” in chimps ANY IDEAS that might EXPLAIN the “missing” part of the chimp’s #2 chromosome, AND the chimp’s “extra” chromosome?

Maybe the chimp’s “extra” chromosome was once part of its short #2. Could the “extra” chromosome match the upper part of our #2? LET’S TRY IT…

Let’s try it… Turn the “extra” one upside down?! Nope! They don’t seem to match. What else could we try? Turn the “extra” one upside down?! Let’s try it…

WOW ! IT WORKED! They DO MATCH! NOW, the next question: “How could this happen?” Was there ONE #2 in our common ancestor, that split to make TWO in chimps, OR Were there TWO short chromosomes in our ancestor that fused (joined) to make ONE in humans?

We DO have a PROBLEM: “How did this difference happen?” And, we have two hypotheses (possible explanations): 1. One split to make two, OR 2. Two fused (joined) to make one Let’s try the second one (fusion). How can we TEST that hypothesis?

But, what kind of evidence can we look for? We could look for evidence of fusion in the middle of our #2 chromosome… But, what kind of evidence can we look for? Well, it so happens that ALL chromosomes have special tip ends, called “telomeres”…

CHROMOSOME PARTS All Chromosomes have telomeres at both ends (like shoelace aglets!) Head Telomere Centromere Tail Telomere Telomeres have a special DNA sequence… ttagggttagggttagggttagggttagggttaggg… |||||||||||||||||||||||||||||||||||| aatcccaatcccaatcccaatcccaatcccaatccc…

Did you notice the repeated sequence: ttaggg? Head Telomere DNA Sequence for Telomeres: ttagggttagggttaggg… |||||||||||||||||| aatcccaatcccaatccc… Centromere NOTICE: Tandem Repeats in Telomeres: ttagggttagggttaggg… |||||||||||||||||| aatcccaatcccaatccc… Tail Telomere “ttaggg” is repeated 800-1600 times in each Telomere

Here’s another view of a chromosome, showing the telomeres untwisted, and their typical DNA sequence It also shows that the upper (shorter) arm above the centromere is called the “p-arm”, and the lower (longer) arm is called the “q-arm”

and its “extra” chromosome (right) TELOMERE DNA CLOSE-UP Here are ends of the upper telomeres of the chimp’s “short” chromosome (left)… and its “extra” chromosome (right) Short #2 “Extra”

They do NOT fit when one telomere is twisted 180o (right) NOTICE! When we turn the “extra” chromosome upside-down, and try to connect it to the “short” chromosome, it only FITS one way (left)… They do NOT fit when one telomere is twisted 180o (right)

Reading the top strand only, see: T T A G G G C C C T A A FURTHERMORE… When we lay the fusion area on its side, we can see more clearly how the DNA sequence changes at the fusion point. Reading the top strand only, see: T T A G G G C C C T A A

…ttagggttagggttagggccctaaccctaaccctaa… THAT’S WHAT YOU WILL BE LOOKING FOR When you are searching the DNA for the Fusion Point, you will be looking at only one strand of DNA (since the “lower” strand is the predictable complement of the “upper” strand). Look for something like this: …ttagggttagggttagggccctaaccctaaccctaa… Read this like lines of text in a book… Do you see where the multiple g’s (and no c’s) END, and multiple c’s (and no g’s) BEGIN?

On which line does the change happen? What would this point be called? (where multiple g’s stop, and multiple c’s begin) This would be the FUSION POINT Raise your hand when you see that point in this actual DNA strand below: On which line does the change happen?

GOT THE PICTURE? Maybe this will show it more clearly: THERE’S the FUSION POINT ! GOT THE PICTURE?

NOW… WHERE should we LOOK for the FUSION POINT? 2a YES! Right in the MIDDLE of our chromosome #2, where the two matching chimp chromosomes overlap ! 2b

(Can you figure out where the number “2q13” comes from?) This would be BELOW the CENTROMERE, in the “q-arm” of the chromosome, in the region known as “2q13”, shown in red. 2a 2b (Can you figure out where the number “2q13” comes from?)

3 = sub-part 3 of that region (OPTIONAL) For “2q13”… 2 = chromosome #2 q = the q-arm 1 = region 1 of that arm 3 = sub-part 3 of that region 2a 2b

So, where can we see the DNA from this region of our #2 chromosome to examine? I have gone to an online DNA database and printed out the DNA in that region. You could do this yourself, but, to save time, I’ve done that for you…

This is what a page looks like… This 2q13 region gives us 52 pages of DNA! This is what a page looks like… On this page, there are 57 lines, each line with 60 bases (letters), and that gives us… 3,420 bases per page!

If these 52 pages were attached end-to-end, they would stretch about 14 meters (16 yards) around your room! AND… If ALL the DNA from our ENTIRE #2 chromosome was printed out like this, it would stretch about 16 km (10 miles)!

Each number on the left edge equals the By the way… Each number on the left edge equals the number of the first base (letter) on that line. And, a space has been inserted after every 10th base (letter) to make counting easier.

You may notice when you are searching, that the “ttaggg” pattern is not perfect! An occasional “c” slips in here and there, and you will see other minor “glitches.” WHY? If you said “MUTATIONS,” you would be right.

You get to SEARCH those 52 pages! NOW, it’s YOUR turn! You get to SEARCH those 52 pages! Are you ready??? Just kidding! Actually, you will form teams of 3-4, and each team gets the same 4 pages (from the “2q13” region)

One of those 4 pages should have the “Fusion Area” Each person looks for that “Fusion Area” on a different page. When one of you finds it, show your partners. Discuss your discovery with your partners, and answer the questions on your “SEARCH” worksheet

PREDICTIONS: If hypothesis is true, we RECAP PROBLEM: How did our #2 chromosome come to look identical to two chromosomes in chimpanzees” Chimp Us HYPOTHESIS: our #2 chromosome was formed by the fusion of two chromosomes in an ancestor, after chimps branched off. Fusion? <--Common Ancestor TEST: Look for fusion evidence in the form of telomere DNA in the middle of our #2chromosome PREDICTIONS: If hypothesis is true, we should find two telomeres there; If NOT true, should be NO telomeres there.

GO SEARCH for the Tell-Tale Telomeres !

Students get into teams now, and pick up team folder with 4 DNA pages per team, and 1 worksheet per student. Go to MMM2 for followup slides, to show after teams find fusion points, or to show optional DNA models of telomeres.