Outline for lecture 4 Assignment 1

Slides:

Advertisements

Similar presentations

Graduation Project Writing the Research Paper.

Advertisements

How to Write Your Works Cited Page

Writing for the College Student

Portfolio Assignment  Communication Improvement Profile (CIP)  15 pts  Speech Materials  10 pts  10 pts each)  30 pts  Final Synthesis.

THE WORKS CITED PAGE Mrs. Geoffroy English II Honors.

By: Ms. Stanley.  The main goal of a research paper is to develop a technical writing style.  The propose of a research paper is to analyze specific.

Technological Debates. Debate Unit Debate Procedure Opening Statement by affirmative (2 minute max) Opening Statement by opposition (2 minute max) Argument.

Alternative Fuel Brochure What would we do if we ran out of Oil?

APA Formatting & Citations. APA Format Your paper should have: 12 inch margins on all sides Aligned left Double spaced Times New Roman font Size 12 point.

Language Development: The Course Jan. 6, The Course Designed to give students a comprehensive understanding of language development, primarily in.

WEB DESIGN UPDATES I HAVE WEB SPACE – WHAT DO I DO NOW??? PRESENTED BY MARY KAY BLACK and CHRISTY RANDALL.

APA Formatting Schwartz et al. Chapter 12 & 14. Running Head An abbreviated title Example: Title: Effects of Type of Lineup on the Accuracy of Children’s.

What is Comedy Presentation GROUP PRESENTATION. What You Will Need  Your outline is an individual grade.  Power Point slide (no more than 10 slides)

Extra-Credit Opportunities! Extra credit is always available on projects and lab reports for those who go way above and beyond the assignment requirements.

Research Paper Computer Information Technology. Research Paper There seems to confusion over when the paper is due. The paper was due 4/6/11. I must have.

Optimization Section 4.7 Optimization the process of finding an optimal value – either a maximum or a minimum under strict conditions.

Chapter 08 Author: Kelly Elkins © 2013 Elsevier, Inc. All rights reserved.

Your paper must include the following: 1. A thesis statement 2.background information about your topic 3. At least two pieces of supporting evidence which.

Analysis of the atp9 5‘ trailer A B At5S-5 Atatp9.Endo.Mega.A atp9 At5S-Mega.R (-239) (-84/- 83) (+180) 5S rRNA 5’ 3’ atp9 mRNA atp9 pre-mRNA atp9 5’ leader.

Intro to Psych Papers and APA Style. What Do You Actually Know About APA? ●Let’s review o APA Interactive Resources APA Interactive Resources.

Lecture 5 Assignment 1 Polymorphic markers MusY marker Polyacrylamide electrophoresis Article 2 discussion.

Chapter 3 – Solving Linear Equations 3.5 – Linear Equations and Problem Solving.

MLA format. What is MLA? O MLA refers to ( Modern Language Association). O It is a professional and academic way in writing academic papers. O It protects.

Section 4.7. Optimization – the process of finding an optimal value- either a maximum or a minimum under strict conditions Problem Solving Strategy –

 Give credit to the sources from which you found your information  Avoid plagiarism  Help your reader locate information about your topic.

INFORMATION X INFO415: Systems Analysis.

Check with your teacher to find out what they want and what they want it called!

UOP COM 220 Week 7 Checkpoint Rough Draft of the Research paper Check this A+ tutorial guideline at

Computer Applications

MLA Format? Grade: ALL Subject: English Date: 2015.

Preparing Your Synposis

Quantitative Detection and Differentiation of Human Herpesvirus 6 Subtypes in Bone Marrow Transplant Patients by Using a Single Real-Time Polymerase Chain.

Test Review Be prepared to provide an answer.

MLA Formatting and Citation.

What did you say about my T-T-T project again???

Formatting Your Essay MLA Style.

What is Plagiarism? What is MLA Format?

Strategy for F1 mutation carrier screening and identification of their mutations. Strategy for F1 mutation carrier screening and identification of their.

PCR-based genotyping assays

a b c Supplemental Figure 3. Kiem et al.

© 2013 Elsevier, Inc. All rights reserved.

Assignment #13 “My Winter Break”

How to Write Your Works Cited Page

Making a Works Cited Page

MLa Formatting.

PCR-based genotyping assays

The font should be Times New Roman and a 12 point font size

Mutations in the Liver Glycogen Phosphorylase Gene (PYGL) Underlying Glycogenosis Type VI (Hers Disease) Barbara Burwinkel, Henk D. Bakker, Eliezer Herschkovitz,

Title Company Logo Discussion Materials & Methods: Conclusion

Individual assignment question

Sex Determination: Balancing Selection in the Honey Bee

<Author(s) Name and Affiliation>

Human Epidermal Differentiation Complex in a Single 2

PUBLISHING GUIDELINES

A Possible Vertical Transmission of Human Papillomavirus Genotypes Associated with Epidermodysplasia Verruciformis Michel Favre, Slavomir Majewski, Nando.

Research Paper Overview.

How to Write Your Works Cited Page

TITLE FONT SIZE: 20 (MAXIMUM) 2 LINES OF TEXT (RECOMMENDED)

Nature of Mitochondrial DNA Deletions in Substantia Nigra Neurons

10th World Studies Turn in: Take out: Works Cited

Works Cited Page Begin your Works Cited page on the next blank page at the end of your paper. It should have the same one-inch margins and last name, page.

Outside Reading Project PAP.

Figure 1. Genomic organization of the murine Pcln1 gene.

Agarose gel electrophoresis of DNA extracted from EDTA and formic acid decalcified bone marrow trephine biopsies. Agarose gel electrophoresis of DNA extracted.

Gonosomal Mosaicism for a Nonsense Mutation (R1947X) in the NF1 Gene in Segmental Neurofibromatosis Type 1 Claudia Consoli, Celia Moss, Stuart Green,

In situ footprinting of the IGRP promoter: primer set C

Genomic structure of LTBP-4 around the 3rd 8-Cys repeat.

In situ footprinting of the IGRP promoter: primer set D

Integration of the kDNA minicircle sequence into the genome of a rabbit with Chagas' disease. Integration of the kDNA minicircle sequence into the genome.

The original gel picture of 28 Salmonella spp. performing BOX- PCR

Presentation transcript:

Outline for lecture 4 Assignment 1 Real-time analysis of Honeybee DNA sequence Honeybee paper

Assignment 1: 13.5 marks Page 1(3.5): Picture of the agarose gel with your lane clearly indicated.

Assignment 1: 13.5 marks Pages 2-5(10): Top of page 2 will be your clipped sequence. Three page maximum description of your analysis and conclusions (2-4). 12 point font minimum; 1.5 line spacing minimum; 1 inch margins; figures (1page max) included. This must be individual work no collaboration. Plagiarism is a serious academic offence. Page 5 references. Expectations are on the web site.

Assignment 1 Due Monday Oct. 20

Page 1: Example gel My lane

T7 sequencing primer?

Tony’s clone Bio396X

GGTAANGGAACTGGAATCCAAACTCTCTGAAGCTGAGAAGGAATTCATCGA Example sequence GGTAANGGAACTGGAATCCAAACTCTCTGAAGCTGAGAAGGAATTCATCGA AGGAGCACCAACACGTAGCAAACGATCACCATCCGAGTGGATACCAAGGCCACCCGAAAAATACAGTCTTACTGGGCACA GAGCTCCTATCAACAGAGTTATTTTCCATCCGGTCTTTAGTCTTATAGTATCTGCCAGCGAAGATGCCACTATCAAGGTG TGGGACTTCGAGAGCGGCGAATTCGAAAGAACGTTGAAGGGGCACACCGACAGCGTGCAGGACGTTTCCTTCGACGTCTC CGGGAAACTGTTAGTCTCATGCAGTGCGGACATGTCTATTAAGTTATGGGACTTTCACCAGTCATTCGCCTGCGTGAAAA CCATGCACGGACATGATCACAGTGTCAGCTCTGTCGCATTTGTGCCACAAGGGGATTTCGTAGTGAGCGCCTCTAGGGAT AAGACCATCAAAATATGGGAAGTAGCGACAGGGTATTGTGTCAAAACGTTAACGGGGCACAGAGAATGGGTACGGATGGC CAGAGTCAGTCCTTGTGGAGAATTAATAGCTAGTTGCTCGAACGATCAAACAGTACGGGTTTGGCACGTGGCAACAAAGG AAACGAAGGTCGAACTCAGAGACCACGAACACGTAGTGGAGTGTATCGCATGGGCACCGGACAGTGCAAGAGCATCGATC AACGCTGCTGCAGGGGCGGACAATAAGGGAGCCCATGAAGGACCTTTCCTCGCATCTGGCTCGCGAGACAAAGTAATTCG TGTATGGGATGTCGGTGCCGGTGTTTGTCTCTTCGCCCTATTGGGCCACGACAACTGGGTTCGCGGCATCGTCTTCCATC CTGGTGGCAAGTTCATCGTCAGTGNCTCTGACGACAAGANCCTGCGAGTATNGGANACGCGCAACANANGGGTAATGAAA ACCCTCNAAGCGCACGTCCACTTCTGCNCCTCCNTTGATTTCACAAAAGCCATCCTTACGTGGTCNCCGGTAGTG

Step into liquid

Taken from Vallee et al., 2001

Taken from Tarricone et al., Neuron 2004

Discussion of Honey Bee paper