Unlocking the mystery of DNA

Slides:



Advertisements
Similar presentations
Unlocking the mystery of DNA
Advertisements

Nucleic Acids The Genetic Material. Two types of Nucleic acids RNA RNA DNA DNA.
Genes and Gene Technology
Discovering the structure of DNA DNA = Deoxyribose nucleic acid Made out of sugars (deoxyribose), phosphates and nitrogen bases.
DNA Deoxyribonucleic Acid. The DNA Connection What have you learned about inheritance, DNA, and cell division up to this point? How do genes determine.
DNA “Deoxyribonucleic acid”
The Structure of DNA.
DNA The Code of Life. Important Facts 1.DNA is the basic substance of heredity *Remember that heredity is the passing on of traits from an organism to.
Date DNA. ✤ DNA stands for deoxyribonucleic acid ✤ DNA carries all the genetic information of living organisms.
 DNA (deoxyribonucleic acid) is a two stranded molecule called double helix  Each strand are made of smaller parts called nucleotides  The two strands.
Introduction to DNA (Deoxyribonucleic acid). What do you know?
What do genes look like?.
DNA The Code of Life. Fredrich Mischer In 1868, a Swiss physician found a new substance inside of cells and named it nuclein. This substance is now known.
DNA Structure, Function & Replication. DNA stands for… DeoxyriboNucleic Acid.
DNA Structure, Function & Replication. DNA stands for… DeoxyriboNucleic Acid.
Molecular Genetics Structure of DNA. Phoebus Levene (1920’s) identified the 3 components of DNA molecule –deoxyribose sugars –phosphate groups –nitrogenous.
 Double helix  Nucleotide  Semiconservative replication  DNA polymerase  Chromatin.
* Make sure tonight’s homework is written in your agenda. * Quietly, discuss and respond to the following questions (answers should be written on your.
Unlocking the mystery of DNA. Cell division and DNA replication Cells divide Growth, Repair, Replacement Before cells divide, they have to double cell.
Deoxyribonucleic Acid Primarily in nucleus Contains the code for making proteins Can’t get out of the nucleus Very large molecule Made of nucleotides.
DNA DNA (Deoxyribonucleic Acid) is the molecule that stores genetic information for all living cells.
DNA. Characteristics of DNA 1. Supplies instructions for cell processes, like how to make proteins 2. Can be copied each time a cell divides 3. It is.
DNA Deoxyribonucleic Acid. Importance of DNA DNA is the code for making proteins Those proteins control your physical features The directions for making.
DNA and Replication, RNA and Transcription, Translation (= Transcription and Translation = processes in protein synthesis)
Gregor Mendel discovered basic laws of heredity using pea plants.
DNA. NUCLEOTIDES: Makes up DNA DNA is made of only 3 units: Sugar Phosphate Base.
The Race to Discover DNA’s Structure
Chapter 12.1 DNA: Molecule of Heredity
Aim: How does DNA replicate itself?
Date: January 5th, 2017 Aim #38: How does DNA replicate itself? HW:
Unlocking the mystery of DNA
PROJECT: Model DNA
DNA DNA Structure Video Clip
DNA Structure and Replication Notes
DNA Structure.
Chapter 4 Section 1 Pages 86-89
DNA and Replication.
Deoxyribonucleic Acid
Introduction to DNA February 9th, 2016.
DNA Biology By PresenterMedia.com.
A molecule that can copy itself!
Unlocking the mystery of DNA
Unlocking the mystery of DNA
What is the structure and function of DNA?
Cells, Heredity & Classification
Ch.6s.1 Genetics: History and Structure of DNA
Topic 3 – Chemistry of Life
DNA Notes.
Discovering the structure of DNA
Deoxyribonucleic Acid
DNA The Blueprint of Life.
DNA Deoxyribonucleic Acid
Science Log: DNA Bubble Map
Cell division and DNA replication
What is the structure and function of DNA?
DNA Structure.
Deoxyribonucleic Acid
Unlocking the mystery of DNA
Additional info: Genes & DNA
Unlocking the mystery of DNA
The Structure of Deoxyribonucleic Acid
DNA The Molecule of Life.
Nucleic Acids & Protein Synthesis
The Pieces of the Puzzle
DNA Structure.
Replication Makin’ copies
DNA Chapter 12.
Structure and Replication
The Structure and Function of DNA
Presentation transcript:

Unlocking the mystery of DNA Liz LaRosa www.middleschoolscience.com 2011 1

Inherited characteristics are determined by genes Prior to the 1950’s What we knew: Inherited characteristics are determined by genes Genes are passes from one generation to the next Genes are part of a chromosome Chromosomes are made of protein and DNA 2

Cell division and DNA replication Cells divide Growth, Repair, Replacement Before cells divide, they have to double cell structures, organelles and their genetic information 3

DNA replication – Mitosis & Meiosis 4

look like, and how did it replicate itself? But… What did DNA look like, and how did it replicate itself? 5

Discovering the structure of DNA Rosalind Franklin (1920-1958) King’s College, London Made significant advances in x- ray diffraction techniques with DNA Her images suggested that DNA had a spiral shape One of her DNA images 6

Discovering the structure of DNA Maurice Wilkins – (1916-2004) King’s College, London Also did X-ray diffraction studies of DNA Worked with Rosalind Franklin Shared information with Watson and Crick 7

Discovering the structure of DNA Erwin Chargaff – (1905-2002) Columbia University, NY Investigated the composition of DNA His findings by 1950 strongly suggested the base-pairings of A-T & G-C Met with Watson and Crick in 1952 and shared his findings “Chargaff’s rule” A = T & C = G 8

Discovering the structure of DNA James Watson (1928) and Francis Crick (1916-2004) Worked together at Cavendish Laboratory in Cambridge to determine the structure of DNA Used work from Franklin, Wilkins, and Chargaff to determine the double helix shape Watson, Crick, and Wilkins were awarded the Nobel Prize Rosalind Franklin passed away (1958) before the Nobel Prize was awarded in 1962 9

Discovering the structure of DNA DNA = Deoxyribose nucleic acid Present in all living cells Contains all the information Nucleotides: a subunit that consists of: a sugar (deoxyribose) a phosphate and one nitrogen base – 4 different bases Adenine (A) and Thymine (T) Guanine (G) and Cytosine (C) 10

DNA – What does my code look like? Computer Code: 10010100111010001100101001110010111100101001001001001011100101000101010010010100101010010010100101001010100101001010010101010101001010100101010111111100 DNA Code: ATTCGGGGCCTTAAGACATTAATTTCCCAAGAAGAGATAAACTAGAGAGACCCTTTAAAACACACAGAGATAGACAGAAAAACAATAGACAGATACAGATAGACATAAAAAATTTTTTGGGAAA…millions and millions of bases… “Gattaca” is a science fiction movie starring Uma Thurman, Ethan Hawke, and Jude Law 11

Practice DNA Base Pairs “Gattaca” is a science fiction movie starring Uma Thurman, Ethan Hawke, and Jude Law 12

DNA replication – helix unzips 13

DNA replication – helix unzips 14

DNA replication – two strands are separated 15

DNA replication – each side is now a template 16

DNA replication – two identical strands of DNA Original DNA strands 17

DNA replication Newly assembled DNA strands 18

Semi-conservative replication DNA replication Semi-conservative replication 19

Build a DNA molecule – you try it! http://learn.genetics.utah.edu/content/begin/dna/builddna/ http://learn.genetics.utah.edu/content/begin/dna/builddna/ 20

DNA replication- you try it! http://www.pbs.org/wgbh/aso/tryit/dna/shockwave.html http://pbs.org/wgbh/aso/tryit/dna/shockwave.html 21