Copyright © 2010 Academic Press Inc.

Slides:

Advertisements

Similar presentations

Keywords: Gene, chromosomes, undifferentiated plasmid, base pairs, Keywords: hydrogen bonds, B2 Topic 1 The Components of Life This topic looks at: DNA.

Advertisements

Chapte r 17 Rearrangement of DNA Introduction 17.2 The mating pathway is triggered by pheromone-receptor interactions 17.3 The mating response activates.

20,000 GENES IN HUMAN GENOME; WHAT WOULD HAPPEN IF ALL THESE GENES WERE EXPRESSED IN EVERY CELL IN YOUR BODY? WHAT WOULD HAPPEN IF THEY WERE EXPRESSED.

GENETICS Recap & Basics. DNA Structure Function Replication.

Introduction to Genetics. Chromosomes Chromosomes are made up of DNA wrapped around proteins. Each chromosome codes for several genes. Each Gene codes.

Gene Regulation Cells switch on different sets of genes according to their position and their history. So in the pictures of the development of the zebra.

SRY Gene on Chromosome Y Jon Scales Genetics Fall GTAACAAAGAATCTGGTAGAAGTGAGTTTTGGATAGTAAAATAAGTTTCGAACTCTGGCA 61 CCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACAATGCAATCATATGCTTCTGCTATG.

How do cells “talk” to each other?

The Differentiation of Vertebrate Immune Cells  In the immune system, two types of cells participate directly in defense against pathogens.  Plasma.

The Genetic Code. The DNA that makes up the human genome can be subdivided into information bytes called genes. Each gene encodes a unique protein that.

Copyright © by Holt, Rinehart and Winston. All rights reserved. ResourcesChapter menu Flow of Genetic Information The flow of genetic information can be.

DNA Structure. The Flow of Genetic Information from DNA to RNA to Protein –DNA functions as the inherited directions for a cell or organism. Copyright.

Aim: How is protein shape determined?. Hormone All are proteins with a specific shape that determines their function. What do enzymes, antigens / antibodies,

HOW DNA WORKS GENETICS - 7 TH GRADE. HOW DNA WORKS Almost every cell in your body contains about 2 meters of DNA. DNA is found in the cells of ALL organisms.

DO NOW Friday’s Lab “DNA Extraction”, we saw DNA spooled out of the test tube. Do you think you could try this on other substances? Why? Name two potential.

19.09 Replication of HIV Slide number: 1

(3) Gene Expression Gene Expression (A) What is Gene Expression?

Proteins & Nucleic Acids

B2 Topic 1 The Components of Life

The nucleus of a cell contains chromosomes. Chromosomes carry genes.

Chapter 5 Cell Division and DNA Replication

Chapter 08 The T Cell Receptor: Proteins and Genes

ABO Blood Type: An Example of Genetic Variation

B2 Topic 1 The Components of Life

محاضرة عامة التقنيات الحيوية (هندسة الجينات .. مبادئ وتطبيقات)

Chapter 14 Gene Control in Development

Chapter 20 Molecular Evolution

Relationship between Genotype and Phenotype

Transcription -The main purpose of transcription is to create RNA from DNA because RNA leaves the nucleus to carry out its functions but DNA does not -A.

Skin-Specific Expression of ank-393, a Novel Ankyrin-3 Splice Variant

Chapter 3 DNA, RNA and Protein

Players in the protein game

What does the word Promoter mean?

Volume 61, Issue 5, Pages (May 2002)

Mating in yeast Stressed diploid yeast undergoes meiosis

Cellular Differentiation

RNA and Protein Synthesis

Chapter 11 Regulation at the RNA Level

Chapter 26 Proteomics: The Global Analysis of Proteins

Relationship between Genotype and Phenotype

Chapter 22 Recombinant DNA Technology

The Differentiation of Vertebrate Immune Cells

Essential Question: How cells make proteins

Chapter 24 Genomics and DNA Sequencing

Chapter 20 Molecular Evolution

Chapter 7 Protein Structure and Function

A Novel Family of Candidate Pheromone Receptors in Mammals

Copyright © 2010 Academic Press Inc.

Chapter 1 Basic Genetics

Chapter 10 Regulation of Transcription in Eukaryotes

Chapter 20 Molecular Evolution

Chapter 25 Analysis of Gene Expression

Copyright © 2010 Academic Press Inc.

Chapter 6 Transcription of Genes

Hiroaki Matsunami, Linda B Buck Cell

Protein Synthesis.

Chapter 18 Bacterial Genetics

Copyright © 2010 Academic Press Inc.

Chapter 23 The Polymerase Chain Reaction

Copyright © 2010 Academic Press Inc.

Chapter 8 Protein Synthesis

Chapter 4 Genes, Genomes and DNA

Chapter 9 Regulation of Transcription in Prokaryotes

DNA & Translation.

Copyright © 2010 Academic Press Inc.

HOW DO LIPID SOLUBLE HORMONES WORK???

A Novel Family of Putative Pheromone Receptors in Mammals with a Topographically Organized and Sexually Dimorphic Distribution Gilles Herrada, Catherine.

Chapter 14 Recombination and Repair

Presentation transcript:

Copyright © 2010 Academic Press Inc. Genomes -What’s it code for -Where do proteins go MEMBRANE PROTEINS: -Pheromone receptors/ Cell type Regulation -Chemoreceptors 1% of all genes in mammals -GPCRs Copyright © 2010 Academic Press Inc.

Copyright © 2010 Academic Press Inc. 12 X 106 bp Copyright © 2010 Academic Press Inc.

Copyright © 2010 Academic Press Inc. ~6000 genes Copyright © 2010 Academic Press Inc.

Copyright © 2010 Academic Press Inc. Protein localization Copyright © 2010 Academic Press Inc.

Copyright © 2010 Academic Press Inc.

Copyright © 2010 Academic Press Inc.

Copyright © 2010 Academic Press Inc.

Copyright © 2010 Academic Press Inc. Man Made Bacteria???? or Man Made DNA Copyright © 2010 Academic Press Inc.

Copyright © 2010 Academic Press Inc. 20% dispensable for this bacterium Copyright © 2010 Academic Press Inc.

Copyright © 2010 Academic Press Inc.

Copyright © 2010 Academic Press Inc. Haploid phase Diploid phase Sporulation Figure 19.19 Copyright © 2010 Academic Press Inc. Copyright © 2010 Academic Press Inc.

Copyright © 2010 Academic Press Inc.

Copyright © 2010 Academic Press Inc. a cells make the a pheromone and alpha pheromone receptor alpha cells make the alpha pheromone and a pheromone receptor Pheromones cause cells to migrate towards each other until they touch and another protein causes cell fusion. 12 amino acids 13 amino acids Figure 19.20 Copyright © 2010 Academic Press Inc. Copyright © 2010 Academic Press Inc.

Copyright © 2010 Academic Press Inc.

Copyright © 2010 Academic Press Inc. No Known function Figure 19.21 Copyright © 2010 Academic Press Inc. Copyright © 2010 Academic Press Inc.

Copyright © 2010 Academic Press Inc.

Copyright © 2010 Academic Press Inc.

Copyright © 2010 Academic Press Inc. Gene Conversion of HML alpha or HMR a Loci into MAT locus Figure 19.22 Copyright © 2010 Academic Press Inc. Copyright © 2010 Academic Press Inc.

Copyright © 2010 Academic Press Inc. HMR a HMR a HML alpha HML alpha Copyright © 2010 Academic Press Inc.

Copyright © 2010 Academic Press Inc.

Copyright © 2010 Academic Press Inc.

Copyright © 2010 Academic Press Inc.

Copyright © 2010 Academic Press Inc. What are phylogenetic trees? Copyright © 2010 Academic Press Inc.

Copyright © 2010 Academic Press Inc.

Copyright © 2010 Academic Press Inc. Mircoarray- Like a a Northern blot Copyright © 2010 Academic Press Inc.

Copyright © 2010 Academic Press Inc. Types of Sections Sagittal (Medial) Coronal Horizontal Copyright © 2010 Academic Press Inc.

Copyright © 2010 Academic Press Inc. In situ mRNA hybridizations on mouse brain tissue Copyright © 2010 Academic Press Inc.

Copyright © 2010 Academic Press Inc.