Gene Editing Design Demo -GenomeEditor 2.0 EGFR Gene Editing Example 1: Create (2369C>T) T790M mutation Example 2: Knockout/knockin: delete a portion of exon #2 and insert a drug selection cassette Example 3: Add a HA Tag to the C-terminus of EGFR GeneHarbor Inc., all rights Reserved http://www.geneharbor.com

Data preparation: starting with the sequence ID: NM_005228 Click on Submit GeneHarbor Inc., all rights Reserved

Retrieved EGFR sequence info Click on Process Data to record the sequence info GeneHarbor Inc., all rights Reserved

Recorded sequence data Click on Blast Genome to the blast page GeneHarbor Inc., all rights Reserved

Launch Blast Human Genome Database Click on Blast and wait for the data to return GeneHarbor Inc., all rights Reserved

Returned Blast data Click on Process Data to record the blast data GeneHarbor Inc., all rights Reserved

Recorded Blast data Step 1. Click on select Exon Group Step 2. Click on Verify Exons GeneHarbor Inc., all rights Reserved

Data preparation completed Defined EGFR exons and introns GeneHarbor Inc., all rights Reserved

Export to Gene Editing Design Form Select Gene editing design GeneHarbor Inc., all rights Reserved

Gene Editing Design Form Mapped amino acid locations Mapped exon and intron locations GeneHarbor Inc., all rights Reserved

Select a focal point and download the extended sequence Example 1: Creation of (2369C>T) T790M mutation Select a focal point and download the extended sequence Step 1: Select 790 aa as focal point Step 2: Click on Download sequence and wait download to complete GeneHarbor Inc., all rights Reserved

Select the sequence to design gRNA oligos for cloning Example 1: Creation of (2369C>T) T790M mutation Select the sequence to design gRNA oligos for cloning Step 1: Select -75/+75 item (75 bp up stream and 75 bp down stream of the focal point) Step 2: Click on Export to gRNA selection GeneHarbor Inc., all rights Reserved

gRNA selection form Example 1: Creation of (2369C>T) T790M mutation Select a gRNA sequence near the focal point GeneHarbor Inc., all rights Reserved

Select vector system to design oligos for cloning Example 1: Creation of (2369C>T) T790M mutation Select vector system to design oligos for cloning Step 1: Select a vector system Step 2: Design oligos GeneHarbor Inc., all rights Reserved

Designed Oligos for selected vector Example 1: Creation of (2369C>T) T790M mutation Designed Oligos for selected vector Forward and reverse complement oligos for gRNA cloning. Copy and save for oligo ordering GeneHarbor Inc., all rights Reserved

Design homologous donor oligo with C to T mutation Example 1: Creation of (2369C>T) T790M mutation Design homologous donor oligo with C to T mutation Select a sequence (-/+75) for editing +75 nn highlighted Target aa (T) GeneHarbor Inc., all rights Reserved

Design homologous donor oligo with C to T mutation Example 1: Creation of (2369C>T) T790M mutation Design homologous donor oligo with C to T mutation Make the change ACG (T) to ATG (M) using key board then highlight +75 nn C to T T changed to M GeneHarbor Inc., all rights Reserved

Save or copy the edited sequence as the donor sequence Example 1: Creation of (2369C>T) T790M mutation Save or copy the edited sequence as the donor sequence copy Reverse complement Highlight the entire sequence. This is the plus donor sequence. Select Reverse Complement menu to get the reverse complemental strand. Both can be copied and saved for ordering. Export sequence GeneHarbor Inc., all rights Reserved

Design PCR primers for validating the editing Example 1: Creation of (2369C>T) T790M mutation Design PCR primers for validating the editing Step 1: Select -/+ 300 item for primer design Step 2: Click on Export to Primer Design GeneHarbor Inc., all rights Reserved

Primer design form Example 1: Creation of (2369C>T) T790M mutation Step 2: Click on design Step 1: Set the locations of forward and reverse primer regions by moving the vertical bars GeneHarbor Inc., all rights Reserved

Designed PCR primers for a regular or nested PCR Example 1: Creation of (2369C>T) T790M mutation Designed PCR primers for a regular or nested PCR PCR primer sequences, copy and save for ordering GeneHarbor Inc., all rights Reserved

Summary: Oligos for EGFR T790M editing Example 1: Creation of (2369C>T) T790M mutation Summary: Oligos for EGFR T790M editing -gRNA cloning to Zhang lab- pX330 : Forward: 5’ caccgTGCAACTCATCACGCAGCTC 3’ Reverse complement: 5’ aaacGAGCTGCGTGATGAGTTGCAc 3’ -Homologous repair donor: Forward: 5’GTGATGGCCAGCGTGGACAACCCCCACGTGTGCCGCCTGCTGGGCATCTGCCTCACCTCCACCGTGCAACTCATCAtGCAGCTCATGCCCTTCGGCTGCCTCCTGGACTATGTCCGGGAACACAAAGACAATATTGGCTCCCAGTACCTG 3’ Reverse Complement: 5’CAGGTACTGGGAGCCAATATTGTCTTTGTGTTCCCGGACATAGTCCAGGAGGCAGCCGAAGGGCATGAGCTGCATGATGAGTTGCACGGTGGAGGTGAGGCAGATGCCCAGCAGGCGGCACACGTGGGGGTTGTCCACGCTGGCCATCAC 3’ -PCR primers for editing validation: Num Name Oligo Sequence Direction Location Amplicom Size Pair 1 NC_018918.2_1_F CTGTGCTAGGTCTTTTGCAGGC Forward 61 - Pair 1 NC_018918.2_1_R GCAGATGGGACAGGCACTGAT Reverse 594 534 Pair 2 NC_018918.2_2_F GGCACAGCTTTTCCTCCATGAG Forward 80 - Pair 2 NC_018918.2_2_R GGCAAACTCTTGCTATCCCAGG Reverse 491 411 GeneHarbor Inc., all rights Reserved

Design a knockout/knockin Example 2: Knockout/knockin within exon 2 Design a knockout/knockin Step 2: Click download sequence Step 1: Select exon 2 start as the focal point GeneHarbor Inc., all rights Reserved

gRNA design Example 2: Knockout/knockin Set 200bp sequence Click on export to gRNA design GeneHarbor Inc., all rights Reserved

Design oligos for gRNA construct Example 2: Knockout/knockin Design oligos for gRNA construct Select gRNA location Select Vector system Oligos for cloning GeneHarbor Inc., all rights Reserved

Design homologous Donor construct Example 2: Knockout/knockin Design homologous Donor construct Step 2: Select 5’ Arm Step 1: Check Assembly GeneHarbor Inc., all rights Reserved

Design donor construct Example 2: Knockout/knockin Design donor construct Select a predesigned CMV-eGFP-IRES-Puro cassette GeneHarbor Inc., all rights Reserved

Design donor construct Example 2: Knockout/Knockin Design donor construct Select 3’-Arm GeneHarbor Inc., all rights Reserved

Donor construct completed Example 2: Knockout/Knockin Donor construct completed Export and save the donor sequence GeneHarbor Inc., all rights Reserved

Export the donor sequence to PCR primer design Example 2: Knockout/Knockin Export the donor sequence to PCR primer design Step 1: Click on Export to Primer Design GeneHarbor Inc., all rights Reserved

Design PCR primers for validating knockout/knockin at 5’ integration Example 2: Knockout/Knockin within Exon 2 Design PCR primers for validating knockout/knockin at 5’ integration Outside 3’Arm Outside 5’ Arm 5’Arm 3’Arm cassette Step 1: click Step 2: Click on Design GeneHarbor Inc., all rights Reserved

Designed PCR primers for validating knockout/knockin at 5’ integration Example 2: Knockout/Knockin Designed PCR primers for validating knockout/knockin at 5’ integration For 3’ integration detection primer design Designed primers for one step or nested PCR. Copy and save oligos for 5’ integration detection GeneHarbor Inc., all rights Reserved

Summary: Oligos for knockout/knockin editing Example 2: knockout/knockin Summary: Oligos for knockout/knockin editing -gRNA cloning to Zhang lab- PX462: Forward: caccgAATAACTGTGAGGTGGTCCT Reverse complement: aaacAGGACCACCTCACAGTTATTc -Homologous repair donor: Sequence not shown -PCR primers for knockout/knockin (5’ integration) validation: # Name Oligo Sequence Direction Location Amplicom Size Pair 1 NC_018918.2_1_F TGGTGAGGGAAGTAACTGTGCC Forward 877 - Pair 1 NC_018918.2_1_R CCTGAGGAGTTAATTTCCGAGAG Reverse 1819 943 Pair 2 NC_018918.2_2_F ATGGAGTGTGGACGAGCATAGG Forward 923 - Pair 2 NC_018918.2_2_R GTTCCCAGCACTGCCCCTCT Reverse 1792 873 * PCR primers for 3’ integration detection can be designed by clicking on 3’ Integration Detection GeneHarbor Inc., all rights Reserved

Design of HA tag insertion at c-terminus Example 3: add HA Tag to the EGFR C-terminus Design of HA tag insertion at c-terminus Step 2: Click on Download Sequence Step 1. Select stop codon as the focal point GeneHarbor Inc., all rights Reserved

Select sequence for gRNA design and cloning Example 3: add HA Tag to the EGFR C-terminus Select sequence for gRNA design and cloning Step 1: Select -/+75 and highlight all sequence Step 2: Export to gRNA design GeneHarbor Inc., all rights Reserved

gRNA selection and oligos for gRNA cloning Example 3: add HA Tag to the EGFR C-terminus gRNA selection and oligos for gRNA cloning GeneHarbor Inc., all rights Reserved

Design homologous donor with a HA tag Example 3: Add a HA Tag to the EGFR C-terminus Design homologous donor with a HA tag Step 1: Select -/+75 item Step 3: Select HA-Tag Step 2: Put the cursor right before the stop codon GeneHarbor Inc., all rights Reserved

Design homologous donor with a HA tag Example 3: add HA Tag to the EGFR C-terminus Design homologous donor with a HA tag HA tag nn sequence HA-Tag aa sequence Export and save sequence for homologous donor repair GeneHarbor Inc., all rights Reserved

Design PCR primers for detecting HA tag insertion Example 3: add HA Tag to the EGFR C-terminus Design PCR primers for detecting HA tag insertion 1. Select -/+300 item 2. Export to Primer Design to design PCR primers for validating tag insertion as described in example 1 GeneHarbor Inc., all rights Reserved

Design PCR primers for detecting HA tag insertion Example 3: add HA Tag to the EGFR C-terminus Design PCR primers for detecting HA tag insertion GeneHarbor Inc., all rights Reserved

Summary: Oligos for HA tag insertion at C terminus Example 3: add HA Tag to the EGFR C-terminus Summary: Oligos for HA tag insertion at C terminus -gRNA cloning to Zhang lab- pX330 : Forward: 5' caccgAATTTATTGGAGCATGACCA 3' Reverse complement: 5' aaacTGGTCATGCTCCAATAAATTc 3' -Homologous repair donor: Forward: 5’ATCTTTAAGGGCTCCACAGCTGAAAATGCAGAATACCTAAGGGTCGCGCCACAAAGCAGTGAATTTATTGGAGCAtacccatacgatgttccagattacgctTGACCACGGAGGATAGTATGAGCCCTAAAAATCCAGACTCTTTCGATACCCAGGACCAAGCCACAGCAGGTCCTC 3’ Reverse Complement: 5’GAGGACCTGCTGTGGCTTGGTCCTGGGTATCGAAAGAGTCTGGATTTTTAGGGCTCATACTATCCTCCGTGGTCAAGCGTAATCTGGAACATCGTATGGGTATGCTCCAATAAATTCACTGCTTTGTGGCGCGACCCTTAGGTATTCTGCATTTTCAGCTGTGGAGCCCTTAAAGAT 3’ Primers for validation: Num Name Oligo_Sequence Direction Location PCR amplicom Pair 1 NC_018918.2_1_F CAGCAGAGACCCACACTACCA Forward 27 - Pair 1 NC_018918.2_1_R GCAACTTCCCAAAATGTGCCCG Reverse 486 460 Pair 2 NC_018918.2_2_F CCCGAGTATCTCAACACTGTCC Forward 76 - Pair 2 NC_018918.2_2_R AATGTGCCCGAGGTGGAAGTAC Reverse 474 399 GeneHarbor Inc., all rights Reserved

Export any region of a genomic sequence with coding annotation Other useful function Export any region of a genomic sequence with coding annotation GeneHarbor Inc., all rights Reserved

Design qPCR primer cross intron-exon Other useful function Design qPCR primer cross intron-exon Intron location and length GeneHarbor Inc., all rights Reserved

Feedback Support@geneharbor.com Toll free 1-800-710-3618 Fax 1-866-264-0551 GeneHarbor Inc., all rights Reserved