By: Tiffany J. Simmons Pd. 6. GGTCCAATGCCCGCCAGCCTAGCTCCAGTGCTTCTAGTAGGAGGGCTGAAAGGGA GCAACTTTTCCTCCAATCCTGGAAATTCGACACAATTAGATTTG AACTC GCTGGAAATACAACACATGTTAAATCTTAAGTACAAGGGGGAAAAAATAAATCAGTTA.

Slides:

Advertisements

Similar presentations

Chemistry 2100 Lecture 10.

Advertisements

Proteins: Structure reflects function….. Fig. 5-UN1 Amino group Carboxyl group carbon.

Supplementary Figure 1A

Oxalate (µmol/gFW) Itaconate (µmol/gFW) r=-0.702** Citrate (µmol/gFW) r=0.389 Isocitrate (µmol/gFW) Ascorbate (µmol/gFW) r=0.052 r=0.195 New Leaves 10.

The Chemical Nature of Enzyme Catalysis

BY: SHERENE MINHAS. Agr Glu Thr Ile Glu Ser Leu Ser Ser Ser Glu Glu Ser Ile Pro Glu Tyr Lys Gln Lys Val Glu Lys Val Lys His Glu Asp Gln Gln Gln Gly Thr.

Aminoácidos Unidad de las proteínas. Isómeros Clasificación Esenciales Valina (Val) Leucina (Leu) Isoleucina (Ile) Fenilalanina (Phe) Metionina (Met)

Chapter 26 Amino Acids Metabolism.

Metabolic fuels and Dietary components Lecture - 2 By Dr. Abdulrahman Al-Ajlan.

• Exam II Tuesday 5/10 – Bring a scantron with you!

5’ C 3’ OH (free) 1’ C 5’ PO4 (free) DNA is a linear polymer of nucleotide subunits joined together by phosphodiester bonds - covalent bonds between.

“Discovery” of MSG … Dr. Kikunae Ikeda (1908) An attentive taster will find out something common in the complicated taste of asparagus, tomatoes, cheese.

Protein-a chemical view A chain of amino acids folded in 3D Picture from on-line biology bookon-line biology book Peptide Protein backbone N / C terminal.

Amino Acids and Proteins 1.What is an amino acid / protein 2.Where are they found 3.Properties of the amino acids 4.How are proteins synthesized 1.Transcription.

Lipids A. Classified based on solubility (like dissolves like) 1. insoluble in polar solvents 2. soluble in nonpolar solvents 3. lipids are hydrophobic.

FIGURE (part 2) Urea cycle and reactions that feed amino groups into the cycle. The enzymes catalyzing these reactions (named in the text) are distributed.

©CMBI 2005 Why align sequences? Lots of sequences with unknown structure and function. A few sequences with known structure and function If they align,

The relative orientation observed for  helices packed on ß sheets.

Protein Structure FDSC400. Protein Functions Biological?Food?

You Must Know How the sequence and subcomponents of proteins determine their properties. The cellular functions of proteins. (Brief – we will come back.

Amino Acids, Peptides, and Proteins.. Classification of Amino Acids.

Lesson today Protein Teacher : Isroli Laboratory : Animal Physiology and Biochemistry Faculty : Animal Agriculture Diponegoro University.

Proteins. The central role of proteins in the chemistry of life Proteins have a variety of functions. Structural proteins make up the physical structure.

This class: Regulation of protein activities (1) What is a protein activity? (2) How to change the rate of a specific cellular activity? (3) Rapid vs slower.

Chapter 27 Amino Acids, Peptides, and Proteins. Nucleic Acids.

Gluconeogenesis By Amr S. Moustafa, M.D.; Ph.D. Assistant Prof. & Consultant, Medical Biochemistry Dept. College of Medicine, KSU

Proteins and Enzymes Nestor T. Hilvano, M.D., M.P.H. (Images Copyright Discover Biology, 5 th ed., Singh-Cundy and Cain, Textbook, 2012.)

How does DNA work? What is a gene?

Protein Synthesis. DNA RNA Proteins (Transcription) (Translation) DNA (genetic information stored in genes) RNA (working copies of genes) Proteins (functional.

BIOCHEMISTRY REVIEW Overview of Biomolecules Chapter 4 Protein Sequence.

Digestion and Absorption Johnson Chap Jack L. Leonard 2004.

Protein turnover Catabolism of amino acids II

Classification of Proteases

LESSON 4: Using Bioinformatics to Analyze Protein Sequences PowerPoint slides to accompany Using Bioinformatics : Genetic Research.

February 14 Chapter 26 Amino Acid Metabolism

Secondary structure prediction

Learning Targets “I Can...” -State how many nucleotides make up a codon. -Use a codon chart to find the corresponding amino acid.

Fig Second mRNA base First mRNA base (5 end of codon) Third mRNA base (3 end of codon)

Welcome Back! February 27, 2012 Sit in any seat for today. You will have assigned seats tomorrow Were you absent before the break? Plan on coming to tutorial.

intro-VIRUSES Virus NamePDB ID HUMAN PAPILLOMAVIRUS 161DZL BACTERIOPHAGE GA1GAV L-A virus1M1C SATELLITE PANICUM MOSAIC VIRUS1STM SATELLITE TOBACCO NECROSIS2BUK.

UNIT 8 THE AMINO ACIDS. LEARNING OBJECTIVES  State the composition and describe the structure of amino acids.  Classify amino acids.  List essential,

End Show Slide 1 of 39 Copyright Pearson Prentice Hall 12-3 RNA and Protein Synthesis 12–3 RNA and Protein Synthesis.

A program of ITEST (Information Technology Experiences for Students and Teachers) funded by the National Science Foundation Background Session #3 DNA &

1 Protein synthesis How a nucleotide sequence is translated into amino acids.

Cell Division and Gene Expression

Amino Acids ©CMBI 2001 “ When you understand the amino acids, you understand everything ”

Proteins Structure of proteins Proteins are made of C, H, O and nitrogen and may have sulfur. The monomers of proteins are amino acids An amino acid.

©2001 Timothy G. Standish Hebrews 12:28 28Wherefore we receiving a kingdom which cannot be moved, let us have grace, whereby we may serve God acceptably.

Biphasic insulin aspart 30 + metformin vs once-daily insulin glargine + glimepiride Kann P, Regulski M, Medding J, Ligthelm R A study in people with type.

Kami, et al. Supplementary Fig. S2A. Kami, et al. Supplementary Fig. S2B.

Amino Acids  Amino Acids are the building units of proteins. Proteins are polymers of amino acids linked together by what is called “ Peptide bond” (see.

Amino acid metabolism IV. Biosynthesis of nonessential amino acids Figures: Lehninger-4ed; fejezet: 22 (Stryer-5ed; fejezet: 24)

Supplementary Fig. 1 Relative concentrations of amino acids after transamination reaction catalyzed by PpACL1, α- ketoglutarate as the amino acceptor.

Stephen Taylor i-Biology.net Photo credit: Firefly with glow, by Terry Priest on Flickr (Creative Commons)

Amino Acids and Proteins Amino Acids. L-isoleucine.

Amino acids Common structure of 19 AAs H3N+H3N+ COO - R H C Proline.

COO - R group Amino group Carboxylic group L -Form Amino Acid Structure  H = Glycine CH 3 = Alanine H N 3 + H Juang RH (2004) BCbasics.

Fibrous Proteins Examples 1. a-keratins 2. Silk Fibroin 3. Collagen

Genomics Lecture 3 By Ms. Shumaila Azam. Proteins Proteins: large molecules composed of one or more chains of amino acids, polypeptides. Proteins are.

Arginine, who are you? Why so important?. Release 2015_01 of 07-Jan-15 of UniProtKB/Swiss-Prot contains sequence entries, comprising

Collagen By: Yurani Farfan.

Cathode (attracts (+) amino acids)

Gluconeogenesis Mainly occurs in cytosol

Figure 3.14A–D Protein structure (layer 1)

Amino Acids Amine group -NH2 Carboxylic group -COOH

How to Test an Assertion

Chapter 18 Naturally Occurring Nitrogen-Containing Compounds

Presentation transcript:

By: Tiffany J. Simmons Pd. 6

GGTCCAATGCCCGCCAGCCTAGCTCCAGTGCTTCTAGTAGGAGGGCTGAAAGGGA GCAACTTTTCCTCCAATCCTGGAAATTCGACACAATTAGATTTG AACTC GCTGGAAATACAACACATGTTAAATCTTAAGTACAAGGGGGAAAAAATAAATCAGTTA TTTGAAACATAAAAATGAATACCAAGGACCTGATCAAATTTCACACAGCAGTTTCC TTGCAACAC(TTCAGCTCCCCATGCTCCAGAATACCCACCCAAGAAAATAATAGGCTT TAAAACAATATCGGCTCCTCATCCAAAGAACAACTGCTGATTGAAACACCTCATTAGC T GTGTAGAGAAGTGCATCTTATGAAACAGTCTTAGCAGTGGTAGGTTGGGAAGGAGAT AG

Rabbit A -Ala Leu Ser Asp His His Ile Tyr Leu Glu Gly Thr Leu Leu Lys Pro Asn Met Val Thr Pro Gly His Ala Cys Thr Gin Lys Frog A- Ala Leu Ser Asx His His Val Tyr Leu Glx Gly Thr Leu Leu Lys Pro Asx Met Val Thr Ala Gly Asx Ala Cys Thr Glx Lys Cod A- Ala Leu Ser Asp His His Val Tyr Leu Gin Gly Thr Leu Leu Lys Pro Asp Met Val Thr Ala Gly His Ser Cys Thr Gin Lys Rabbit C- Ala Leu Ser Asx His His Ile Tyr Val Gix Gly Thr Leu Leu Lys Pro Glx Met Val Thr Pro Gly Asx Ala Cys Thr Glx Lys Rabbit B- Ala Leu Asn Asp His His Val Tyr Leu Glu Gly Thr Leu Leu Lys Pro Asn Met Val Thr Ala Gly His Ala Cys Thr Lys Ox B- Ala Leu Asn Asp His His Val Tyr Leu Glu Gly Thr Leu Leu Lys Pro Asn Met Val Thr Ala Gly His Ala Cys Thr Lys Lys Rat B- Ala Leu Asn Asp His His Val Tyr Leu Glu Gly Thr Leu Leu Lys Pro Asn Met Leu Thr Ala Gly His Ala Cys Thr Lys Lys Human- Ala Leu Asn Asp His His Val Tyr Leu Glu Gly Thr Leu Leu Lys Pro Asn Met Val Thr Ala Gly His Ala Cys Thr Lys Lys

By: Tiffany J. Simmons Pd. 6

Aldolase- An enzyme that is used to convert glucose (sugar) into energy. There are three different classifications of Aldolase: A,B, and C Aldolase A: This is mainly found as an embryo. There are very small parts left in the adult tissue. Aldolase B: Is mainly found in the main organisms such as the Kidney, the intestines, and the liver. Aldolase C: This is found in the brain. Each of these play an important role in giving the body the proper energy that is needed.

The main organisms that use this protein are: Kidneys’ Livers’ The intestines’ And very small in the brain.

I chose this protein because it interested me in how much the body really does need this protein. Besides being in major organisms Aldolase is found all over the body such as in the nervous system. If the Aldolase is increased in your body you can be in physical danger.

What Abnormal Results Mean Greater than normal levels of aldolase may be due to: Damage to skeletal muscles Hepatitis Infectious mononucleosis Liver, pancreatic, or prostate cancerprostate cancer Muscular dystrophy Myocardial infarction Polymyositis Aldolase is all over the body, but is mostly found in muscle tissue. When someone has muscle or liver damage the Aldolase level will be raised higher.