Evolutionary history of related organisms Phylogeny - Review Evolutionary history of related organisms

Distinguishing Phylogeny vs. Taxonomy Taxonomy – a hierarchical structure of grouping & naming or classifying organisms based on similarities and differences Phylogeny – Depicts the evolutionary relationships of a group of organisms. Phylogenetic trees indicate when/where species diverged from a common ancestor.

Taxonomy vs. Phylogeny a d b e c ( ) ( ) ) ) ) ) A taxonomy A Phylogeny Taxonomy is simply the classification of organisms or a scheme of classification. Taxonomy often utilizes a phylogeny. A phylogeny depicts evolutionary histories or relatedness.

Are these trees the same? The shape of the tree doesn’t matter c b e a a d b e c d

Don’t be distracted by morphological similarity Turtle Lizard Crocodile Sparrow Most Recent Common Ancestor (MRCA) Note one can add all sorts of info onto trees. Character changes, biogeography, chemical features, time, etc. Is a crocodile more closely related to a lizard or a sparrow?

Is a newt more closely related to a lizard or a human? The newt shares the same MRCA with the lizard and human. Fish Newt Lizard Mouse Human The newt is neither more closely related to the lizard or the human – it is equally related to both since they share the same common ancestor. Note one can add all sorts of info onto trees. Character changes, biogeography, chemical features, time, etc.

Branching order is all that matters Just because ‘d’ has a “straight shot” does not mean it is more related to the common ancestor than the others Branches can rotate at nodes!

Unless stated otherwise, assume that absolute time is NOT represented C D e f g Was e before or after f? Was e before or after g?

A tree can depict polytomy plant animal fungi Maybe we are unsure which of these is true: plant fungi animal A polytomy indicates we do not know how these three lineages relate to each other

A monophyletic group ( ) is the basic unit of classification. clade A monophyletic group ( ) is the basic unit of classification. Moss Clubmoss Fern Horsetail Pine Corn Archaeopteris Clades = branch-systems have a special importance in understanding diversity. They are monophyletic. Monophyletic groups include an ancestor and all of their descendants. (all members are most-closely related). They are “natural.”

Monophyletic group (clade)

In this lab, you will examine: • How taxonomies and phylogenies compare. • How phylogenetic trees can be developed using basic set analysis, and parsimony analysis with and without bootstrapping. • How parsimony analysis of DNA sequences can be used to determine phylogenetic relationships. • How to interpret phylogenetic trees.

How are organisms classified? ((A,(B,C)),(D,E,F)); Using set relationships to develop a phylogenetic tree! ( ) define similarities among taxa , indicate a common ancestor ; = end of set or tree

((A,(B,C)),(D,E,F)); Present Past Remember trees are not absolute time unless otherwise stated so two nodes that seem equal do not equate to equal time. Past

Using Morphology: Carry out set analysis for 10 species of succulent plants in the family Crassulaceae. Type your analysis, e.g. ((A,(B,C)),(D,E,F)); into a word document and save as a text document. Open the text doc using FigTree – File – Open File – Export Graphic – Standard JPEG format Rename file and save Open to be sure it contains the tree Compare your tree to that of other groups – Differences? Similarities? Reasons? 1. Open “Word” and save your set data as the only information in a separate text file. The following is an example of the text that would be in the text file. ((A,(B,C)),(D,E,F)); To make it easier to find, title the file, “A to F Tree test 1”, and put it in a new Phylogeny Lab folder. 2. Open FigTree. a) Click on [File] [Open] and select your “A to F Tree Test 1” text file. The program should produce a tree for your set data if it is set up correctly. If no tree appears check to make sure all parentheses, commas and semicolons are where they should be. b) To save a copy of the tree, click on [File] [Export Graphic..] In the blue dropdown bar - Select “Standard JPEG format” [Browse] to the file you will save it in. Rename the file, e.g. instead of export.jpg – Rename it Practice Tree A to F, etc. Open the saved file to be sure it contains the tree.

Build your Morphological Tree Study the images of your plant species Using any morphological characters you deem important, infer a phylogeny for them Create your .txt file to open in FigTree Don’t forget to annotate the morphological characters used Study your tree and make changes in the taxonomy if needed We’ll compare trees BEFORE moving on with this PowerPoint Instructors stop the PowerPoint here!

Build your Morphological Tree STOP the presentation here and have students build their morphological trees before continuing.

The parsimony analysis Select the tree that implies the minimum number of character changes summed across all characters of interest

How can we infer a phylogeny? Many methods, some quite sophisticated Simplest is to extend the principle of parsimony Occam’s Razor - All other things being equal, the simplest solution is the best. Can be done on Morphological or Molecular data

Review – Using molecular data B A O O T G G A A A G C G A A B G C A A A C G C A C T

Three possible trees C B A O A B C O O A O C C B A B Tree 1 Tree 2 B A

Map the characters onto tree 1 2 3 4 5 C B A O T G G A A O 3 A G C G A A C T B 1 2 1 C

Actually there is more than one way to map character 3 1 2 3 4 5 C B A O 3 T G G A A O 3 3 A G C G A A C T B C Either way the character contributes 2 steps to the overall cost

Map the characters onto tree 1 2 3 4 5 C B A O T G G A A O 4 5 3 A G C G A A C T B 1 2 C Total cost (length) = 6 steps

Map the characters onto tree 2 1 2 3 4 5 A B C O T G G A A O 4 5 A G C G A A C T 3 B 1 2 C Length = 5

Tree 3 Length = 6 steps 1 2 3 4 5 B A C O T G G A A O 3 4 5 A G C G A

What was the cost of each tree? The most parsimonious tree C B A O A B C O O A C B Tree 1: length = 6 Tree 2: length = 5 B A C O O A Tree 3: length = 6 B C

How do we evaluate uncertainty? One commonly used method: bootstrap analysis Bootstrapping is a resampling technique that allows us to make inferences about a dataset that may be, statistically, too small to do so otherwise. In the case of our lab, we are bootstrapping our gene sequences to expand our dataset by making what are called pseudo- replicates. A bootstrap support value is similar to a probability. If 100 trees were sampled for your dataset and only 50% of the time did you recover clade A, that clade has a bootstrap support of 50.

Bootstrapping Create “pseudoreplicate” data sets One TACATAAACAAGCCTAAAATGCGACACTACGTTCACTGTTACGCTCTCCACTGCCTAGACGAAGAAGCTTCA Two TACATAAACAAGCCCAAAATGCGACACTACGTCCACTGTTATGCTCTCCACTGCCTAGACGAAGACGCTTCA Three TACATAAACAAGCCCAAAATGCGACACTACGTCCACTGTTACGCTCTTCACTGCCTAGACGAGGATGCCTCG Four TACATAAATAAGCCAAAAATGCGACACTACGTTCATTGTTACGCACTCCATTGCCTCGACGAAGAAGCTTCA Five TACATAAACAAACCCAAAATGCGACACTACGTCCACTGTTATGCTCTCCACTGTCTAGACGAAGACGCTTCG Six TACATAAACAAGCCCAAGATGCGTCACTACGTCCACTGCTACGCCCTCCACTGTCTCGACGAGGAGGCCTCG Seven TACATAAACAAACCAAAAATGCGACACTACGTCCATTGTTACGCCCTACACTGCCTAGACGAAGACGCTTCA Eight TACATAAACAAACCAAAAATGCGACACTACGTCCATTGTTACGCCCTACACTGCCTAGACGAAGACGCTTCA C G T C C Bootstrapping is a way of testing the reliability of the dataset. It creates a pseudoreplicate dataset by resampling. Each pseudoreplicate sequence will be as long as the original sequences. One Two Three Four Five Six Seven Eight T ................................................................. .................................................................

Bootstrap procedure Make many pseudo-replicates Find the most parsimonious (MP) trees for each Calculate the proportion of the time that the MP trees contain a clade (“bootstrap percentage”) Clades with high bootstrap support are better supported

What we hypothesize What we get Bootstrap Polytomy 20 90 30 99 95 95 If bootstrap values are low, they are unresolved or can be depicted by a polytomy. They indicate either a divergence event more complex than a perfect bifurcation or they simply show uncertainty in the data. 95 45 What we hypothesize What we get

MEGA Analysis Demonstration Conduct an analysis in MEGA on the 20 Crassulaceae species molecular sequences. Compare this analysis to the one you did with morphological characteristics alone. What is similar? What is different? Reasons?