Identifying human disease genes Overview Position independent methods Positional cloning Synteny Drosophila mutants that are positional candidates for human disease genes

Identifying human disease genes Overview of the process

Identifying human disease genes Position independent methods Complementation

14_13.jpg 14_13.jpg

Identifying human disease genes Position dependent methods CF gene chromosome jumping and walking

Identifying human disease genes Mouse and human synteny

Identifying human disease genes Drosophila and human disorders

Genetic testing Overview Examples CF gene

Genetic testing CF testing ARMs OLA Sequencing Heteroduplex screening DGGE Mismatch cleavage

Genetic testing Oligonucleotide arrays

18_09_2.jpg

18_09_3.jpg 18_09_3.jpg

Genetic testing Forensics Species identification Paternity testing DNA quantitation Human identification

Complex Biomaterials? Presence of human DNA? No Yes Exclusively human? If not human, What? Yes No Mixed species? Single contributor? No Yes DNA quantitation

Non human DNA quantitation using intra-SINE PCR Name Class Order Family Genus & species Repeat element 1 Cow Mammalia Artiodactyla Bovidae Bos taurus 1.711B bovine repeat 2 Pig Suidae Sus scrofa PRE-1 SINE 3 Chicken Aves Galliformes Phasianidae Gallus gallus CR1 SINE 4 Ruminants N/A Bov-tA2 SINE 5 Horse Perissodactyla Equidae Equus caballus Ere-1 SINE/horse 6 Dog Carnivora Canidae Canis familiaris SINEC_CF SINE/dog 7 Cat Felidae Felis catus B2_Mv SINE/carnivores 8 Rat Rodentia Muridae Rattus norvegicus L1_RN LINE/L1 9 Mouse Mus Musculus RSINE1 SINE/B4 10 Hamster Cricetulus griseus B2_Mm2 SINE/B2 11 Guinea Pig Caviidae Cavia procellus ID3 SINE/ID 12 Rabbit Lagomorpha Leporidae Lepus C_Oc SINE/rabbit 13 Birds L3b LINE/CR1 14 Waterfowl Anseriformes Anatidae

100 bp DNA ladder Negative control Cow Horse Pig Sheep Deer Dog Cat Rat Mouse Hamster Guinea pig Rabbit Chicken Duck Dove Human 100 bp DNA ladder Negative control Cow Horse Pig Sheep Deer Dog Cat Rat Mouse Hamster Guinea pig Rabbit Chicken Duck Dove Human 100 bp DNA ladder Negative control Cow Horse Pig Sheep Deer Dog Cat Rat Mouse Hamster Guinea pig Rabbit Chicken Duck Dove Human A E I Avian Equine Mouse B F J Waterfowl Hamster Canine C G Guinea Pig Feline D H Rat Rabbit

Our Assay Design Objectives Human Specific a. Comparison of genomic sequences b. Testing complex biomaterials 2. Target Specific a. Comparison of target sequences b. Testing for non-specific amplification 3. Multiplex Compatible a. ABI Prism 7000 default PCR conditions b. Experimentally optimized PCR reagents FAM VIC NED

Nuclear DNA

Schematic of inter-Alu and intra-Alu PCR Inter-Alu PCR 5’ Alu 3’ 3’ Alu 5’ 5’ Alu 3’ 5’ Alu 3’ tail to tail head to head tail to head Intra-Alu PCR 5’ Alu Element 3’

Nuclear DNA target design Intra-Alu Yb8 AluY GGCCGGGCGCGGTGGCTCACGCCTGT AATCCCAGCACTTTGGGAGGC CGA 50 AluYb8 ........................... ....................... GGCGGGCGGATCACGAGGT CAG GAGATCGAGACCATCCTGGCTAACACGG 100 ......T......T ............ .....................A.. TGAAA CCCCGTCTCTACTAAAAATAC AAAAAATTAGCCGGGCGTGGTGGC 150 .......................... .................C...... GGGCGCCTGTAGTCCCAGCTACTCGG GAGGCTGAGGCAGGAGAATGGCGT 200 ......................................... ......... GAACCCGGGAGGCGGAG CTTGCAGTGAGCCGAGAT CGCGCC ACTGCA C TC 250 ..........A............... T ........... G .. A ------- GCCT GGGC GACAGAGCGAGACTCCGTCTC AAAAAA 287 . GCAGTCCG ............................. ...... 294 PCR primers TaqMan-MGB probe

Serial dilution of human nuclear DNA 100 ng 10 ng 1 ng 0.1 ng 0.01 ng 1 pg

Nuclear DNA linear quantitation range nDNA y = -1.4761Ln(x) + 21.236 R 2 = 0.9998 14 16 18 20 22 24 26 28 30 32 34 0.001 0.01 0.1 1 10 100 DNA (ng) Threshold PCR cycle Nuclear DNA linear quantitation range VIC

Mitochondrial DNA

Mitochondrial DNA assay PCR primers TaqMan-MGB probe Incorporates specific diagnostic bases at the 3’ ends of each primer

Mitochondrial DNA linear quantitation range mtDNA y = -1.4769Ln(x) + 22.547 R 2 = 0.9999 14 16 18 20 22 24 26 28 30 32 34 0.001 0.01 0.1 1 10 100 DNA (ng) Threshold PCR cycle FAM

Y chromosome DNA

Human Y-chromosome DNA assay design Human X-chromosome 90 bp deletion in the X-Y homologous region PCR primers TaqMan-MGB probe

Human Y chromosome locus fixation Population Males Females Total African-American 150 141 291 European-American 49 60 109 Hispanic-American 9 7 16 North-American 75 54 129 South-American 12 19 Asian 15 14 29 305 288 593

Male Y DNA linear quantitation range y = -1.4935Ln(x) + 34.74 R 2 = 0.9994 27 29 31 33 35 37 39 0.1 1 10 100 DNA (ng) Threshold PCR cycle NED

Multiplex Analysis

Multiplex Analysis Amplicon compatibility 2. Human specificity a. Test assays and modify amplicons 2. Human specificity a. Analyze mixed DNA samples 3. Background amplification a. Analyze DNA from nearest neighbors

“DNA mixtures” to test human specificity Contents Human male Dog Cat Total template Mix DNA (ng) % 1 50 25 100 2 5 2.5 10 3 0.5 4.5 45 4 0.05 4.95 49.5 0.005 4.995 49.95

Linear quantitative range of nDNA / mtDNA duplex y = -1.4761Ln(x) + 21.236 R 2 = 0.9998 mtDNA y = -1.4769Ln(x) + 22.547 = 0.9999 14 16 18 20 22 24 26 28 30 32 34 0.001 0.01 0.1 1 10 100 DNA (ng) Threshold PCR cycle The open symbols along each standard curve represent detection of human DNA within a mixed sample. nDNA VIC mtDNA FAM

Duplex background amplification 18 20 22 24 26 28 30 32 34 Human genomic Human nuclear Bonobo Common chimp Gorilla dog cat rat mouse rabbit cow horse sheep pig deer chicken NTC DNA Source Threshold PCR cycle nDNA mtDNA

Linear quantitative range of a nDNA / mtDNA / male triplex PCR assay y = -1.8375Ln(x) + 30.479 R 2 = 0.9974 nDNA y = -2.1185Ln(x) + 29.336 = 1 Male Y y = -1.3824Ln(x) + 35.492 = 0.9958 18 20 22 24 26 28 30 32 34 36 38 40 0.01 0.1 1 10 100 DNA (ng) Threshold PCR cycle The open symbols along each standard curve represent accurate detection of human DNA within a mixed sample. VIC FAM NED

Triplex background amplification 24 26 28 30 32 34 36 38 40 Human Male Human Female Bonobo Common chimp Gorilla dog cat rat mouse rabbit cow horse sheep pig deer chicken NTC DNA source Threshold PCR cycle nDNA mtDNA Male Y

Linear quantitative ranges DNA template 100 ng 10 ng 1 ng 100 pg 10 pg 1 pg nDNA Each assay individually mtDNA Male Y Duplex Triplex

Duplex PCR for Human Sex Typing X PCR primers Y PCR primers TaqMan-MGB probes

Duplex PCR for Human Sex Typing

Mobile elements serve as “genomic fossils” of human ancestral lineages.

Human Population Biology and Investigative Forensics 1. Since the dispersal from Africa, mobile elements have continued to expand in the human genome. 2. Many elements are polymorphic and occur at high/low frequencies in human populations. 3. These elements can be exploited to examine human population history. 4. Display-based PCR methods can be used to “extract” recent, population-indicative elements.

Inferring Geographic Affiliation Series of genetic markers (100 Alu loci) Database of human variation (currently 715 individuals of known ancestry) Genotype unknown sample Analytical approach (Structure analysis) Forensic Sci. Intl. (In press) Forensic Sci. Intl. (In press)

Identifying 18 Unknown DNAs Forensic Sci. Intl. (In press)