The triplet code Starter A DNA molecule is 23% guanine.

Slides:

Advertisements

Similar presentations

Modelling Protein Synthesis Jessie Maher. In this experiment, we produced a simple model of a section of DNA, and modelled the processes involved in protein.

Advertisements

Do Now:.  TRANSCRIPTION: process that makes an RNA copy of DNA.  RNA is single-stranded, and T is replaced by U (A-U; G-C)  RNA polymerase makes RNA,

2.7 DNA Replication, transcription and translation

10-2: RNA and 10-3: Protein Synthesis

DNA & genetic information DNA replication Protein synthesis Gene regulation & expression DNA structure DNA as a carrier Gene concept Definition Models.

Transcription & Translation

PROTEIN SYNTHESIS.

PROTEIN SYNTHESIS BY: SOPHIE GOLLAN. In this experiment we modelled the structure of DNA and the processes involved in protein synthesis from the information.

PROTEIN SYNTHESIS In this experiment we modeled the structure of DNA and the processes involved in protein synthesis.

Transcription Transcription is the synthesis of mRNA from a section of DNA. Transcription of a gene starts from a region of DNA known as the promoter.

Take me to NZQA Documents relating to this standard AS Describe the role of DNA in relation to gene expression Protein Synthesis Part three…

Bio 1010 Dr. Bonnie A. Bain. DNA Structure and Function Part 2.

VII RNA and Protein Synthesis

By: Anne Russell, Madelyn Stroder, Hannah Black, And Bailey Mills.

What is the job of p53? What does a cell need to build p53? Or any other protein?

The Genetic Code.

Do Now: On the “Modeling DNA” handout, determine the complimentary DNA sequence and the mRNA sequence by using the sequence given.

12-3 RNA and Protein Synthesis

PROTEIN SYNTHESIS The formation of new proteins using the code carried on DNA.

Section 12-3 RNA & Protein Synthesis

Chapter 8 Section 8.5: Translation 1. Objectives SWBAT describe how mRNA codons are translated into amino acids. SWBAT summarize the process of protein.

What is central dogma? From DNA to Protein

Cell Protein Production. Transcription : process of mRNA formation. 1. Triggered by chem. messengers from cytoplasm which bind to DNA 2. This causes release.

Do Now: On the “Modeling DNA Transcription & Translation” handout, figure out the compimentary DNA sequence AND the mRNA sequence.

Protein Structure. Primary Structure  The primary structure is the sequence of amino acids, which is different for each protein.

The student is expected to: 4B investigate and explain cellular processes, including homeostasis, energy conversions, transport of molecules, and synthesis.

Ribonucleic Acid RNA.

More about proteins Proteins are the building block of our bodies. They make up many components (muscle, skin) or direct the synthesis of components (bone,

Do Now: On the “Modeling DNA” handout, determine the complimentary DNA sequence and the mRNA sequence by using the sequence given.

Question of the DAY Jan 14 During DNA Replication, a template strand is also known as a During DNA Replication, a template strand is also known as a A.

The Central Dogma of Molecular Biology DNA  RNA  Protein  Trait.

RNA & Protein Synthesis Continued: Translation. Translation: mRNA Protein Translation is taking mRNA and making proteins Sequence of nucleotide bases.

Placed on the same page as your notes Warm-up pg. 48 Complete the complementary strand of DNA A T G A C G A C T Diagram 1 A T G A C G A C T T A A C T G.

PROTEIN SYNTHESIS The formation of new proteins using the code carried on DNA.

Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.

Transcription and Translation Chapter 21. Objectives Summarize how genetic information is encoded in DNA, how it provides instructions for making proteins.

All proteins consist of ________. 1.DNA molecules 2.RNA molecules 3.triglyceride chains 4.polypeptide chains

12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.

In this experiment we modeled the structure of DNA and the processes involved in protein synthesis.

DNA to RNA to Protein. RNA Made up of 1. Phosphate 2. Ribose (a sugar) 3. Four bases RNA bases are: Adenine Guanine Cytosine Uracil (instead of thymine)

Basics of RNA structure and modeling

Protein Synthesis Jan 2006.

(3) Gene Expression Gene Expression (A) What is Gene Expression?

Unit 4: Genetic Information, Variation and Relationships between Organisms Lesson 2 The Triplet Code A sequence of three DNA bases, called a triplet,

Gene Expression: From Gene to Protein

BTY100-Lec#4.2 DNA to Protein (Central Dogma).

Protein Synthesis.

Proteins and Translation

Protein Synthesis.

Protein Synthesis- the "STuff of Life".

Protein Synthesis in Detail

Old News TRANSCRIPTION: process that makes an _______ ___________ of DNA. RNA is ________________, and ___ is replaced by ___ (A-U; G-C) RNA___________________.

DNA Test Review.

Gene Expression: From Gene to Protein

January 4th, 2017 Get out a clean sheet of paper, title it Unit VIII Warm-ups and answer the following questions: A section of DNA has the following sequence:

12-3 RNA and Protein Synthesis

The nucleus is the 'command center' of the cell

12-3 RNA and Protein Synthesis

It’s Wednesday!! Don’t be content with being average. Average is as close to the bottom as it is to the top!

12-3 part 2 Genetic Code and Protein Synthesis

Higher Biology Unit 1: 1.3 Transcription.

GENE EXPRESSION / PROTEIN SYNTHESIS

CHAPTER 17 FROM GENE TO PROTEIN.

Protein Synthesis- the "STuff of Life".

DNA DNA replication – DNA function – Triplets / codons.

Friday March 27, 2015 Day 1 1. Please have these Items on your desk.

Protein Synthesis Jan 2006.

Unit 4 - The Natural Environment and Species Survival

DNA DeoxyriboNucleic Acid

Presentation transcript:

The triplet code Starter A DNA molecule is 23% guanine. What percentage of each of the other bases would it contain? G = 23% C + G = 46% C = 23% A = 27% T = 27% So A + T = 54% (to make a total of 100%)

Aims: What is a gene? How do genes code for polypeptides?

A gene is a section of DNA nucleotides that codes for the sequence of amino acids that make up a particular polypeptide.

Depending on the specific groups in each amino acid the polypeptide chain then forms secondary & tertiary structures

The triplet code Only 20 amino acids Each amino acid has its own code of bases on the DNA 3 bases code for an amino acid (triplet code) 64 codes so some amino acid have more than one code. In eukaryotes much of the DNA doesn’t code for amino acids – introns Sections of DNA that code for a.a - exons Introns found between and in genes

Features of the triplet code Few amino acids have only a single triplet code Most have between 2-6 triplet codes each Degenerate code Always read in one direction Start of a sequence is always the same triplet code – methionine 3 triplet codes are stop codons Code is non-overlapping and universal

Understanding checkpoint An enzyme is a protein that is responsible for speeding up chemical reactions. An enzyme’s shape is crucial to it’s function. How would a change in one base result in an enzyme becoming non-functional?

Aims: Explain to your partner What is a gene? How do genes code for polypeptides?