Put Your Dukes Up AT5G03220! Studying Embryo Lethality of

Slides:



Advertisements
Similar presentations
Diagnosis with PCR This is a preparation of DNA. We zoomed in a portion of a gene. We know that two primers, Forward and Reverse, will hybridize at specific.
Advertisements

Arabidopsis thealiana AT3G56230 AT4G18650 What are the functions of them? Are they important for seed development? Spring 2004 Mariko Onozawa.
The Trihelix Transcription Factor Family Heather Hernandez.
HC70AL Presentation: Gene-Knockout Analysis Arabidopsis Thaliana
Zinc Finger CONSTANS- Related and LOB-Domain Containing Genes Nancy Phang June 4, 2004.
What are the Methods and Approaches Used to Identify and Study Arabidopsis Seed Knock- Out Mutations? Eric Newton Garen Polatoglu Rena Schweizer.
At5g A mutant phenotype? Emily Eder HC70AL - Spring 2005.
1.Generate mutants by mutagenesis of seeds Use a genetic background with lots of known polymorphisms compared to other genotypes. Availability of polymorphic.
What Are the Methods and Approaches Used Study Knock-Out Mutations? Elaine Chiu Nancy Phang June 4, 2009.
The MYB and BHLH Transcription Factor Families by Elaine Chiu.
The Maize ropD Gene Christine Neou Dr. John Fowler Botany and Plant Pathology.
F-Box Containing Tubby Transcription Factor Family Daisy Robinton Goldberg Lab Spring 2006.
HC70AL Final Presentation Chris McQuilkin June 4 th, 2009.
Genes That Direct Transcription Co-activator Proteins : Do they disrupt/alter seed development? Gene 1: At5g09250 Gene 2: At5g09240 Combiz Richard Abdolrahimi.
The SET-Domain Containing Protein and MYB-related Families: Genes AT2G05900 & AT1G17460 Kristin Gill HC70AL Spring 2008.
Fig. S1 Mass spectra analysis of XXT4 reaction products demonstrating xylosyltransferase activity towards cellohexaose substrate. Predominant peaks represent.
The HAT2 Homeodomain-Like Transcription Factor Family: Genes AT5G47370 and AT4G17460 Bekah Charney HC70AL Spring 2006.
Ctcgaacttgtttttggttcatctctcaaaaccaaaatcactaaagaggagaagattgctaaagtttgataaaacattccaaaatca ATGGCTGATAGGATCAAAGGTCCATGGAGTCCTGAAGAAGACGAGCAGCTTCGTAGGCTTGTTGTTAAATACGGTCCAAGAAACTGG.
THE FUNCTION OF AT5G04410 (NAC2) AND AT3G10500 (NAC2-like) NAC Family
Daisy Robinton Matt Emmer Jason Chai
The Role of Genes AT5G48150 and AT2G04890 in Arabidopsis thaliana Seed Development Jennifer Huynh June 8, 2006 Honors Collegium 70AL Professor Bob Goldberg.
The C3HC4-Type RING Zinc Finger and MYB Transcription Factor Families Matthew Taube June 5, 2008 HC70AL.
Homeobox leucine zipper protein 9 (HAT9) -AT2G Homeodomain(s) -Leucine Zipper Motif -DNA Binding -Dimerization ?? ~ Helix-turn-helix 5’3’ FWRV.
Determining Functionality of Arabidopsis Thaliana Genes in Embryo Development Ria Yagnik.
Arabidopsis Thaliana A Study of Genes and Embryo Development By Garen Polatoglu.
Is My Gene Important for Seed Development in Plants?? Gene: AT3G53370 Jonathan Milgrom Spring 2004.
Finding a gene based on phenotype Model organisms ’s of DNA markers mapped onto each chromosome – high density linkage map. 2. identify markers linked.
SC.912.L.16.3 DNA Replication. – During DNA replication, a double-stranded DNA molecule divides into two single strands. New nucleotides bond to each.
NAC Family Genes AT1G01720 AT1G77450
Supplemental Fig. S1 A B AtMYBS aa AtMYBS
Searching for the Genes that Control Seed Development
a b LB T-DNA RB Par WT PAR1/LAT4 Actin2 5’UTR 3’UTR At1g31830 Intron c
Are At1g08810 and At3g50060 Important to Arabidopsis Seed Development?
SUMOylated SIZ1 may play an important role
Emily Eder HC70AL - Spring 2005
From: Three Novel Pax6 Alleles in the Mouse Leading to the Same Small-Eye Phenotype Caused by Different Consequences at Target Promoters Invest. Ophthalmol.
Map-based cloning of interesting genes
Is AT2G23290 Important in Seed Development?
Welcome to the world of two Arabidopsis genes:
The Alfin-like PHD Zinc Finger Transcription Factor Family
Does Gene AT5G19490 Play a vital role in seed development?
HC70AL Final Presentation
HC70AL Oral Presentation
Relationship between Genotype and Phenotype
What is AT5G03500? --Background and Structure--
At2G37120: A Gene Exploration
Volume 10, Issue 3, Pages (March 2017)
Searching for a Knockout Line for a Gene of Interest in Arabidopsis
Relationship between Genotype and Phenotype
Rotation review Gaurav Moghe Genetics Program
Arabidopsis Transcription Factor Genes NF-YA1, 5, 6, and 9 Play Redundant Roles in Male Gametogenesis, Embryogenesis, and Seed Development  Jinye Mu,
Volume 5, Issue 2, Pages (March 2012)
Genes Code for Proteins
Relationship between Genotype and Phenotype
Volume 48, Issue 4, Pages (November 2012)
DNA and the Genome Key Area 6a & b Mutations.
Heat Shock Factor Protein Family of Transcription Factors
Supplemental Figure 3 A B C T-DNA 1 2 RGLG1 2329bp 3 T-DNA 1 2 RGLG2
Molecular cloning of pms916 salt hypersensitive T-DNA mutant.
Quick genetics review.
DNA and the Genome Key Area 6a & b Mutations.
Ovaries and Female Phenotype in a Girl with 46,XY Karyotype and Mutations in the CBX2 Gene  Anna Biason-Lauber, Daniel Konrad, Monika Meyer, Carine deBeaufort,
Arabidopsis Thaliana Gene AT5G58610
Volume 7, Issue 1, Pages (January 2014)
A Presenilin-1 Truncating Mutation Is Present in Two Cases with Autopsy-Confirmed Early-Onset Alzheimer Disease  Carolyn Tysoe, Joanne Whittaker, John.
Arabidopsis Gene At1G49560 Maria Garcia June 5, 2008.
Volume 5, Issue 6, Pages (December 2003)
Searching for a Knockout Line for a Gene of Interest in Arabidopsis
Volume 5, Issue 6, Pages (November 2012)
The bHLH Transcription Factors MYC2, MYC3, and MYC4 Are Required for Jasmonate- Mediated Inhibition of Flowering in Arabidopsis  Houping Wang, Yang Li,
Presentation transcript:

Put Your Dukes Up AT5G03220! Studying Embryo Lethality of Knockout T-DNA Mutagenesis on Arabidopsis Thaliana Genes By Aditi S. Hendi

What was studied of AT5G03220? Physical Characteristics and Descriptive Analysis of Gene Determination of T-DNA Insertion Candidates for Knocking Out the Gene Activity at Various Stages in Plant Development of Gene Genotyping Plants Affected or Exposed to T-DNA Effect of Results of Genotyping

What is AT5G03220? Located on Arabidopsis Chromosome 5 Reverse Complementary Oriented Has 6 exons, 5 introns, 2 5’ UTRs, & 1 3’ UTR AT5G03210 is 4167 bp downstream and AT5G03230 is 656 bp upstream to it

What else is known about AT5G03220? Codes for transcriptional co-activator or related gene Contains the F-box motif on the amino-terminus Works in conjunction with other proteins in the regulation of transcription

How does Scarlet Runner Bean model mRNA activity of Arabidopsis? Approximations of activity levels of ortholog SRB gene was used to model those expected of Arabidopsis (right) The mRNA of the gene was found to be inactive, or present in trace amounts, in the flower organs of SRB However it was only an approximation…

When is AT5G03220 active in Arabidopsis Thaliana? Mutant line results indicate more up-regulation post-24-Hr seed stage, and more down-regulation slightly after 30 days after pollination As compared to the Wild Type activities of mRNA corresponding to AT5G03220, activities are affected by the mutation in the Lec1 Mutants.

Who wants to Knockout AT5G03220? T-DNA Madison Screens ~612 bp ~408 bp ~500 bp 500 Knockout candidates for AT5G03220 were identified to be contained in Superpool 1 (left), DNA Pool 6 (right) of the Madison Lines. Sequencing results were repetitively unsuccessful in giving definitive results. Expected sizes of amplified product were predicted to be between 400 and 615 bp in length from Autoradiography.

Using SALK Lines to Genotype SALK line 109178 was chosen due to its position in a 5’UTR of the gene. Plants exposed to the T-DNA were assayed for Wild Type and Mutant alleles in hopes to find an embryo lethal form of the gene. It was determined with the first ten extracted DNA samples that their genotypes were all homozygous Wild Type.

Is this T-DNA Insertion Embryo Lethal? All ten samples displayed the presence of at least one Wild Type Allele, and through T-DNA specific PCR, it was verified that all of the plants were homozygous for the Wild Type allele. So far, results obtained suggests the high possibility that the SALK 109178 insertion may cause embryo-lethality in gene AT5G03220. Further assays on a second set of extracted DNA samples will serve to create a more robust set of data from which to draw a definitive conclusion as will dissecting siliques to provide phenotypes to the genotypic descriptions obtained.

The fight ain’t over yet! Hopefully, with the verification with the next set of DNA of embryo-lethality, the focus will shift to a more in depth study of AT5G03220. Applications in agriculture have enormous potential in terms of improving seed viability through the research of these knockouts.