Characterisation of the sub-class B2 metallo-β-lactamase

Slides:



Advertisements
Similar presentations
Helicobacter pylori Expresses an Autolytic Enzyme: Gene Identification, Cloning, and Theoretical Protein Structure Eleonora Marsich,1 Pierfrancesco Zuccato,1.
Advertisements

Abstract Enterococci are a part of the normal flora of the human intestine and can reach concentrations of up to 10 8 CFU/gram in feces. As an opportunistic.
Expression Vector Expression of cloned genes produces large quantities of protein Components of expression vector 1. replication origin 2. polylingker.
Purification of bioengineered proteins CPSC 265 Week 12.
Purification of Lipase NONG Yuan Supervisor: Prof. Jan-Christer Janson Department of Surface Biotechnology Uppsala Biomedical Center Uppsala University.
Affinity Chromatography Yongting Wang Jan07. What is AC? Affinity chromatography (AC) is a technique enabling purification of a biomolecule with respect.
Metal Chelate Affinity Chromatography Wenbo Dong Yagmur Yagdiran.
Introduction recombinant expression of protein disulfide isomerase (PDI) using the model plant Arabidopsis thaliana Eun Ju Cho ABE workshop 2007.
Goal: To identify yeast gene products important for accurate chromosome transmission in mitosis. Importance: Errors during chromosome transmission in humans.
Manufacture of Human Interleukin 13 Protein Using a Prokaryotic Expression System Ryan Rupp, York College of Pennsylvania, Department of Biological Sciences.
Table 5-1 Protein Purification Essential for characterizing individual proteins (determining their enzymatic activities, 3D structures, etc.) Two main.
A lysine cluster in domain II of Bacillus subtilis PBP4a plays a role in the membrane attachment of this C1 PBP A lysine cluster in domain II of Bacillus.
Cornell University 2009 ASA-CSSA-SSSA Meetings High C/N ratio Refugia pH & aeration Physico- chemical sorption Surface change Microbes Nutrients Amending.
Additional file 1 Figure S1 Figure S1. SDS-PAGE analysis of the expression of sbOMT1 and sbOMT3 enzymes in E. coli. The cells were cultured in an LB medium.
Supplementary Table 1. Purification of Chi-V from E. coli Step Protein Activity Specific activity Yield (mg) (mmol/min) (mmol/min/mg) (%) Crude extract.
1234M 36 kDa Supplementary Fig. 1 Supplementary Fig. 1. Expression and purification of Bacillus sp. BRC1 Bdh in/from E. coli. Lane 1, total.
Proteomics The science of proteomics Applications of proteomics Proteomic methods a. protein purification b. protein sequencing c. mass spectrometry.
Group 4 Data Diane Meas The 3 A-Michaels (get it??) 3 amigos… a-michaels….
Supplemental Figure 1a. SDS-PAGE analysis showing OMPs expressed by V. tubiashii strain From left to right, Lane 1, cells grown in the presence.
Jun Xu, Taifo Mahmud* and Heinz G. Floss* Department of Chemistry, University of Washington, Box , Seattle, WA Identification and Characterization.
Figure 5: Expression and solubility tests for constructs of CoVs. Coronaviruses are complex, positive-sense RNA viruses that cause mild to severe respiratory.
BTE 204: Fundamentals of Genetic Engineering
Determining Gene Specific Chromatin Differences in Sulfolobus solfataricus: Expression of MerR Protein for Targeted-ChIP Antibody Production Background.
Prof. Hee Joo, Lee June, 8, Introduction P. aeruginosa –Nosocomial pathogen –Ability to acquire resistance to several antibiotics –Emergence of.
Figure S1. Production of recombinant NS1 protein
Sesha Kiran Kollipara, Vikas Solanki and Bikash Mandal
OVEREXPRESSION OF TRUNCATED ARA H2
Target protein Additional file 3. SDS-PAGE showing the degree of purification of D1-26PtxtPL1-27 expressed in E. coli. PtxtPL1-27.
TRNA Synthetases in Mycobacteria Ram Gopal Nitharwal, Chandra Sekhar Mandava & Suparna Sanyal.
Assembly of MtGimα and MtGimβ into a hexameric complex with high α‐helical content. Assembly of MtGimα and MtGimβ into a hexameric complex with high α‐helical.
NDM-1 could still evolve:
D-739/181 50th ICAAC Sept , 2010 Boston
RESULTS AND DISCUSSION
Table 1: Resistance profile
Volume 32, Issue 1, Pages (October 2008)
Affinity Chromatography
Characterization of an ADAMTS-5-mediated cleavage site in aggrecan in OSM- stimulated bovine cartilage  M. Durigova, M.Sc., P. Soucy, B.Sc., K. Fushimi,
Figure 1. Molecular modeling of : a) GES-1 and b) GES-1P174E
Antibiotic resistance
Volume 5, Issue 7, Pages (July 1995)
Diagnostic detection of Streptococcus pneumoniae PpmA in urine
Glen S. Cho, Jack W. Szostak  Chemistry & Biology 
Volume 8, Issue 2, Pages (February 2001)
C th Interscience Conference on Antimicrobial Agents and Chemotherapy October 25-28, Washington, DC Examining Temocillin Activity in Combination.
C th Interscience Conference on Antimicrobial Agents and Chemotherapy October 25-28, Washington, USA Emergence of VIM-2 Metallo--lactamase.
Eric C Bolton, Albert S Mildvan, Jef D Boeke  Molecular Cell 
An FAD-Dependent Pyridine Nucleotide-Disulfide Oxidoreductase Is Involved in Disulfide Bond Formation in FK228 Anticancer Depsipeptide  Cheng Wang, Shane.
Serine-like proteolytic enzymes correlated with differential pathogenicity in patients with acute Acanthamoeba keratitis  F.R. de Souza Carvalho, L.C.
John T. Arigo, Kristina L. Carroll, Jessica M. Ames, Jeffry L. Corden 
Adam C Bell, Adam G West, Gary Felsenfeld  Cell 
(a) (b) FhGALE M U I S W1 W2 E1 E2 E3 M - +
Analysis of Proteins with Caseinolytic Activity in a Human Stratum Corneum Extract Revealed a Yet Unidentified Cysteine Protease and Identified the So-Called.
Interaction with PCNA Is Essential for Yeast DNA Polymerase η Function
Volume 23, Issue 3, Pages (March 2016)
Tanya T. Paull, Martin Gellert  Molecular Cell 
Volume 17, Issue 1, Pages (January 2010)
Structure and function of mutationally generated monomers of dimeric phosphoribosylanthranilate isomerase from Thermotoga maritima  Ralf Thoma, Michael.
Nature of the Nucleosomal Barrier to RNA Polymerase II
RAD51 is essential for L. donovani.
How Integration of Positive and Negative Regulatory Signals by a STAND Signaling Protein Depends on ATP Hydrolysis  Emélie Marquenet, Evelyne Richet 
Volume 12, Issue 11, Pages (November 2005)
Human isolates of Aeromonas possess Shiga toxin genes (stx1 and stx2) highly similar to the most virulent gene variants of Escherichia coli  A. Alperi,
Volume 25, Issue 21, Pages (November 2015)
Volume 23, Issue 4, Pages (April 2015)
Analysis of GFP expression in gfp loss-of-function mutants.
BT_0370 galactokinase and BT_371 glucose/galactose transporter
Oxidative Protein Folding Is Driven by the Electron Transport System
Michael J. Lee, Henrik G. Dohlman  Current Biology 
Reconstitution of the Transcription Factor TFIIH
AppA Is a Blue Light Photoreceptor that Antirepresses Photosynthesis Gene Expression in Rhodobacter sphaeroides  Shinji Masuda, Carl E. Bauer  Cell  Volume.
Presentation transcript:

Characterisation of the sub-class B2 metallo-β-lactamase of Yersinia mollaretii Wauters Mercuri P.S.1, Blétard S.1, Kerff F.2 and Galleni M.1 Macromolécules Biologiques1 and Cristallographie des Macromolécules Biologiques2 , Centre d’Ingénierie des Protéines, Université de Liège, Liège, Belgium INTRODUCTION Yersinia mollaretii (Y. mollaretii) strains were isolated from a terrestrial ecosystem. There is no evidence that these organisms are pathogenic for humans. Y. mollaretii bacteria are find in food, soil, water, and environment samples, but several others were isolated from human, mainly from stools of patients with diarrhea (1). In this work we studied the metallo-β-lactamase (MBL) produced by Y. mollaretii Wauters DMS 18520 and known as Y. mollaretii ATCC 43969 in other collection. The search for newsubclass B2 MBLs was done using the CphA sequence as the template (Fig 1). We identified five potential new enzymes (2). All of the structural features that characterized a subclass B2 MBLs are highly conserved in all of the proteins. III. Kinetic parameters of the Y. mollaretii sub-class B2 MBL. The enzymatic profile was studied on a representative numbers of carbapenems and compared to the steady state kinetic parameters of CphA enzyme (Table 1). Hydrolysis of antibiotics was followed by monitoring the variation of absorbance of carbapenems antibiotic in 50mM MES pH6.0. Table 1. Comparison of the catalytic properties of Y. mollaretii and CphA sub-class B2 metallo-β-lactamases. IV. Influence on the Y. mollaretii sub-class B2 MBL activity (Fig. 4). Enzyme activity was measured by monitoring the initial rates of hydrolysis of 100µM of Imipenem in 50mM MES pH 6 in presence of increasing zinc concentration. Figure 1. ClustalW aligment of subclass B2 MBL. CLUSTAL 2.1 multiple sequence alignment.C.violaceum: Chromobacterium violaceum ATCC12472; P.ferrooxidans: Pseudogulbenkiania ferrooxidans; C.piscinae: Chromobacterium piscinae; A.hydrophila CphA: Aeromonas hydrophila CphA; P. chlororaphis: Pseudomonas chlororaphis; S.Fonticola Sfh-I: Serratia Fonticola Sfh-I; Y.mollaretii: Yersinia mollaretii ATCC 43969, I. Cloning of the gene coding for Y. mollaretii sub-class B2 MBL. The extraction of genomic DNA was realised by the help of Wizard Genomic DNA purification kit. Two oligos YblaUP NedI and YblaRP BamHI, (respectively GCCATATGTTAAAAACAATATTACAA and CCGGATCCTTATTACTTATTAGCGGCTTC) were synthetised on the basis of the sequence NCBI Reference: NZ_AALD02000006.1 Figure 2 shows the PCR amplification. The gene Y. mollaretii sub-class B2 MBL (742 bp) was cloned into pJET 1.2 vector and subcloned for the production into pET 26b. Std PCR Figure 4. Zn effect on the Y. mollaretii sub-class B2 MBL and CphA V. Inactivation by Zn-chelating agents. The loss of the metallo-β-lactamase was monitored in the presence of different concentrations of EDTA (Fig.5) and dipinolic acid (Fig.6). The progressive inactivation was monitored by analysing the hydrolysis of 100µM Imipenem in 50 mM MES pH6.0 1000bp 750bp Y. mollaretii MBL gene Figure 2. PCR amplification of the gene coding for Y. mollaretii sub-class B2 MBL. II. Overexpression and purification of the MBL from Y. mollaretii. The enzyme was produced in E. coli Rosetta (DE3) pLysS with the help of overexpression vector as pET26b. The metallo-β-lactamase was produced in TB medium at 18°C in presence of 100 µM IPTG and was purified in three steps, an ion exchange chromatography (Sepharose SP-HP column), a Pentadentate Chelator (PDC) Zn column, followed by a molecular sieve column Superdex 75 (Fig. 3a and b.) The theorical mass of the enzyme is 25547 Da. Figure 5. Inactivation of Y. mollaretii sub-class B2 MBL and CphA by EDTA. MW A B C D E 25 kDa Figure 6. Inactivation of Y. mollaretii sub-class B2 MBL and CphA by dipicolinic acid. CONCLUSIONS In this work, we studied the Y. mollaretii sub-class B2 MBL. It is a strict carbapenemase. Compared to CphA, the enzyme hydrolyses efficiently only imipenem and is less influenced by the presence of zinc ions, suggested that the affinity for the second zinc is lower. In addition, the enzyme was less affected by the presence of metal chelator as EDTA and dipinolinic acid. The comparison of the model strcuture of the Yersinia enzyme and CphA indicate three mutations that can affect the activity toward carbapenem, namely the presence of Y63, T158 and S236. Figure 3b. SDS-PAGE after passage through a Superdex HR75 molecular sieve column. Lane A= load sample, lanes from B to E elutions purified fractions (from 6 to 9). Figure 3a. Elution of Y. mollaretii sub-class B2 MBL on a Superdex HR75 molecular sieve column. REFERENCES 1. Wauters G, l Janssens M.,. Steigerwalt A. G. and Brenner don J.1988.Yersinia mollaretii sp. nov. and Yersinia bercovieri sp. nov., Formerly Called Yersinia enterocolitica Biogroups 3A and 3B Int. J. Syst. Bacteriol. 424-429. 2. Bottoni C, Perilli M, Marcoccia F, Piccirilli A, Pellegrini C, Colapietro M, Sabatini A, Celenza G, Kerff F, Amicosante G, Galleni M, Mercuri PS. 2016. Kinetic Studies on CphA Mutants Reveal the Role of the P158-P172 Loop in Activity versus Carbapenems. Antimicrob. Agents Chemother. 60:3123-3126.