**This may be expedited depending on PRMC SOP

Slides:



Advertisements
Similar presentations
CANCER SCREENING 2011 DELAWARE CANCER EDUCATION ALLIANCE STEPHEN S. GRUBBS, M.D. HELEN F. GRAHAM CANCER CENTER DELAWARE CANCER CONSORTIUM OCTOBER 5, 2011.
Advertisements

What type of study is this?
April 6, o What is cancer? o Cancer statistics o Cancer prevention and early detection o Cancer disparities o Cancer survivorship o Cancer research.
Colorectal cancer: How do we approach health disparities? Marta L. Davila, MD, FASGE University of Texas MD Anderson Cancer Center.
Lung Cancer Lung cancer is a disease in which body cells grow uncontrollably starting in the lungs.
Biology in Focus, HSC Course Glenda Childrawi, Margaret Robson and Stephanie Hollis A Search For Better Health Topic 11: Epidemiology.
GGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTACCC TGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGG
Flow Diagram of the Main HOPE Trial and the HOPE-TOO Trial Extension The HOPE and HOPE-TOO Trial Investigators JAMA. 2005;293:
Trimonabant – tackling a modern epidemic Jusni Saladdin Development Head, Metabolic Diseases.
Tim Wiemken PhD MPH CIC Assistant Professor Division of Infectious Diseases University of Louisville, Kentucky Confounding.
The Inflammatory Breast Cancer Cancer Registry Paul H. Levine, M.D. Paul H. Levine, M.D. The George Washington University School of Public Health and Health.
Epidemiological Research. Epidemiology A branch of medical science that deals with the incidence, distribution, and control of disease in a population.
Pancreatic Cancer In 2012 there were 43,920 cases of pancreatic cancer. 10% of these cases have a family clustering of pancreatic cancers and associated.
Breast cancer affects 1 in 8 women during their lives. 1 Population Statistics.
Reduced Lung Cancer Mortality Risk Among Breast Cancer Patients Treated With Anti- Estrogens Rapiti E et al. SABCS 2009;Abstract 35.
Levels of Evidence Dr Chetan Khatri Steering Committee, STARSurg.
Human Biology Presentation Guidance February 2015.
CHEST 2014; 145(4): 호흡기내과 R3 박세정. Cigarette smoking ㅡ the most important risk factor for COPD in the US. low value of FEV 1 : an independent predictor.
Boksoon Chang, MD ; Jung Hye Hwang, MD ; Yoon-Ho Choi, MD ; Man Pyo Chung, MD, PhD ; Hojoong Kim, MD, PhD, FCCP ; O Jung Kwon, MD, PhD ; Ho Yun Lee, MD.
Cancer screening and cancer diagnosis. All medical advice is that the earlier you discover a cancer the greater your odds are of beating it. In part this.
Controversies in Screening
Hereditary Cancer Predisposition: Updates in Genetic Testing
EPID 503 – Class 12 Cohort Study Design.
Screening for Ovarian Cancer
A Search For Better Health Topic 11: Epidemiology
Breast Cancer Awareness
Evidence-based Medicine
Reducing Nonessential Cognitive Load to Improve Health-related Data-based Reasoning: Results from a Pilot Experiment Sam Schimke – First Author Kathryn.
Present: Disease Past: Exposure
Comparison of three Observational Analytical strategies
Endometrial and other cancers in the menopause
Conclusions AUD:s are common among hospitalised patients
Lung cancer prevalence on the rise (Nov. 2014)
Interpreting numbers – more tricky bits
Cancer.
Breast cancer screening recommendations
Family Tree Presentation
Causes of Cancer.
Consultant Respiratory Physician Professor of Primary Care Oncology
Public Health Phase 3A Abigail Aitken
Yes, Patient #1 Yes, Patient #3 EGFR sequencing chromatograms
Breast Cancer SKRINING
Does One Size Fit All in Obesity Management?
INCIDENCE.
Pediatric Antiepileptic Treatment Strategies
Ovarian Cancer Facts and Figures
Counseling Patients About Germline BRCA Mutations
Smoking and Cancer Facts:
Nat. Rev. Urol. doi: /nrurol
EXPERIMENTAL STUDIES.
Volume 138, Issue 5, Pages e2 (May 2010)
Atherosclerosis Insights
Gender and Tobacco.
Standard 3.1 Patient Navigation Process
Adherence to Medical Regimes
Epidemiology MPH 531 Analytic Epidemiology Cohort Studies
In focus – Emerging issues in cancer control
Ovarian Cancer Facts and Figures
Non-communicable disease, health, disease
3-year survival of lung cancer patients in the general population and in those with a prior diagnosis of chronic obstructive pulmonary disease (COPD).
Epidemiological Designs
What Does BRCA Have to Do With It? PARP Inhibitors in Ovarian Cancer
Citation: Cancer Care Ontario
- - - TABLE 1 A cohort study Vitamin deficiency Depression +
Measures of Disease Frequency, Effect and Impact
Effect Modifiers.
Development of 28 public molecular laboratories in France for molecular testing. Development of 28 public molecular laboratories in France for molecular.
Evidence Based Diagnosis
Prevalence of germline T790M.
Presentation transcript:

**This may be expedited depending on PRMC SOP Study targets cancer patients under active tx or with evidence of disease currently PRMC reviews** **This may be expedited depending on PRMC SOP Study targets cancer survivors Participants are at high risk of cancer* OR cancer is a study outcome Study excludes cancer patients/survivors Yes No PRMC does not review *Examples: -lung CT study of lung cancer detection in smokers -risk-reducing drug in women with BRCA1/2 mutations -large population study of diet patterns and cancer incidence Definition of “high risk”: incidence of cancer over the course of the study is expected to be higher than general population incidence