HC70AL Oral Presentation

Slides:



Advertisements
Similar presentations
Arabidopsis thealiana AT3G56230 AT4G18650 What are the functions of them? Are they important for seed development? Spring 2004 Mariko Onozawa.
Advertisements

Determining the roles of the BTB genes At2g04740, At4g08455, At1g04390, and At2g30600 in Arabidopsis thaliana growth and development. Brandon D. Blaisdell,
The Trihelix Transcription Factor Family Heather Hernandez.
HC70AL Presentation: Gene-Knockout Analysis Arabidopsis Thaliana
Zinc Finger CONSTANS- Related and LOB-Domain Containing Genes Nancy Phang June 4, 2004.
What are the Methods and Approaches Used to Identify and Study Arabidopsis Seed Knock- Out Mutations? Eric Newton Garen Polatoglu Rena Schweizer.
At5g A mutant phenotype? Emily Eder HC70AL - Spring 2005.
What Are the Methods and Approaches Used Study Knock-Out Mutations? Elaine Chiu Nancy Phang June 4, 2009.
The MYB and BHLH Transcription Factor Families by Elaine Chiu.
Mutations in Arabidopsis Exocyst Gene AtSEC8 Jennie Hines Mentor: John Fowler.
A Hypothesis for the function of gene AT4G23180 in A. thaliana By Nicole Foxworth and Deborah Lee (Ether Fowl Ox)
F-Box Containing Tubby Transcription Factor Family Daisy Robinton Goldberg Lab Spring 2006.
HC70AL Final Presentation Chris McQuilkin June 4 th, 2009.
Genes That Direct Transcription Co-activator Proteins : Do they disrupt/alter seed development? Gene 1: At5g09250 Gene 2: At5g09240 Combiz Richard Abdolrahimi.
The SET-Domain Containing Protein and MYB-related Families: Genes AT2G05900 & AT1G17460 Kristin Gill HC70AL Spring 2008.
Single-Factor Punnett Square Notes. Punnett Square A diagram that can be used to predict the gene combinations that might result from a cross.
6.4 Traits, Genes, and Alleles KEY CONCEPT Genes encode proteins that produce a diverse range of traits.
The HAT2 Homeodomain-Like Transcription Factor Family: Genes AT5G47370 and AT4G17460 Bekah Charney HC70AL Spring 2006.
Ctcgaacttgtttttggttcatctctcaaaaccaaaatcactaaagaggagaagattgctaaagtttgataaaacattccaaaatca ATGGCTGATAGGATCAAAGGTCCATGGAGTCCTGAAGAAGACGAGCAGCTTCGTAGGCTTGTTGTTAAATACGGTCCAAGAAACTGG.
THE FUNCTION OF AT5G04410 (NAC2) AND AT3G10500 (NAC2-like) NAC Family
Daisy Robinton Matt Emmer Jason Chai
The study of how traits are passed from parents to offspring.
The Role of Genes AT5G48150 and AT2G04890 in Arabidopsis thaliana Seed Development Jennifer Huynh June 8, 2006 Honors Collegium 70AL Professor Bob Goldberg.
The C3HC4-Type RING Zinc Finger and MYB Transcription Factor Families Matthew Taube June 5, 2008 HC70AL.
Homeobox leucine zipper protein 9 (HAT9) -AT2G Homeodomain(s) -Leucine Zipper Motif -DNA Binding -Dimerization ?? ~ Helix-turn-helix 5’3’ FWRV.
Genetics & Genotyping By Kristin Gill & Daisy Robinton HC70AL Spring 2009.
Determining Functionality of Arabidopsis Thaliana Genes in Embryo Development Ria Yagnik.
Searching for Genes Important in Seed Development At1g19000 At1g74840 BY: Mike Douglas.
Arabidopsis Thaliana A Study of Genes and Embryo Development By Garen Polatoglu.
Is My Gene Important for Seed Development in Plants?? Gene: AT3G53370 Jonathan Milgrom Spring 2004.
Pea In Your Genes. Gregor Mendel Liked to play with pea Noticed that certain Characteristics (inheritable physical features) showed up or disappeared.
1 Mendelian Genetics. 2 Gregor Mendel The Father of Genetics.
NAC Family Genes AT1G01720 AT1G77450
Searching for the Genes that Control Seed Development
Are At1g08810 and At3g50060 Important to Arabidopsis Seed Development?
Emily Eder HC70AL - Spring 2005
Phylgenetic tree.
Performance Indicator 7.L.4A.3
Is AT2G23290 Important in Seed Development?
Intro to Genetics.
Notes – Punnett Squares
Genetics Definitions Definition Key Word
Welcome to the world of two Arabidopsis genes:
The Alfin-like PHD Zinc Finger Transcription Factor Family
Does Gene AT5G19490 Play a vital role in seed development?
HC70AL Final Presentation
Put Your Dukes Up AT5G03220! Studying Embryo Lethality of
The same gene can have many versions.
What is AT5G03500? --Background and Structure--
The same gene can have many versions.
Genetics A Monk and his Methods.
At2G37120: A Gene Exploration
The same gene can have many versions.
Genes, Traits & Alleles.
The student is expected to: 6A identify components of DNA, and describe how information for specifying the traits of an organism is carried in the DNA.
Searching for a Knockout Line for a Gene of Interest in Arabidopsis
Introduction to Genetics and Heredity
Genetics Crosses Ch. 9.2 (p )
HC70AL Research Presentation
Monohybrid Genetics Gregor Mendel
Genetics.
Incomplete Dominance.
Heat Shock Factor Protein Family of Transcription Factors
Arabidopsis Thaliana Gene AT5G58610
Volume 7, Issue 1, Pages (January 2014)
Arabidopsis Gene At1G49560 Maria Garcia June 5, 2008.
Searching for a Knockout Line for a Gene of Interest in Arabidopsis
Test Crosses.
Looking at incomplete and codominance
Presentation transcript:

HC70AL Oral Presentation Roman Groisberg Spring 2004

YES! Knockout in Salk line 006218 What is the structure of AT3G09735? Does a Knockout exist for AT3G09735? Knockout in Salk line 006218 Madison DNA pool 141 Madison Superpool 16

Where is AT3G09735 expressed in the Arabidopsis thaliana? Expressed at higher Levels in maturation stages! Where is the ortholog for AT3G09735 gene expressed in Scarlet Runner Bean? Expressed in all organs Except flowers.

What protein does AT3G09735 encode for? S1Fa DNA Binding protein What is the predicted structure of the protein? Coil-Helix-Coil-Helix-Coil Protein kinase C phosphorylation site N-myristoylation site What is the function of the protein? Gene repressor

What are the genotyping results? Salk plants 1-9: Fw/Rv primer +Tubulin T-DNA/RV +Tubulin Conclusion: No T-DNA insertions in plants 1-18

What are the phenotyping results? Wild type: Salk line 006218: Trichome Silique Flower Conclusion: No Difference

Cannot be determined without further research Is AT3G09735 important for seed development? Cannot be determined without further research What is next? Genotype more Salk Plants to find: homozygous T-DNA heterozygous T-DNA Genotype plants from other facilities that also have a knockout for at3g09735 Cross plants with knockouts in other S1Fa family genes and see if seeds develop with multiple S1Fa genes knocked out Crystalize protein to determine actual structure of S1Fa