Evolving Resistance: Research Goals and Goods

Slides:

Advertisements

Similar presentations

Slide 6.2. Slide 6.3 Dominance and recessiveness - both alleles may encode proteins; example - eye colour -the gene that encodes the protein that "does.

Advertisements

Sequences, Sequences,Sequences and what they might mean.

History, protohistory and prehistory of the Arabidopsis thaliana chromosome complement Henry Yves et al 2006, in press.

Comparative genomics Joachim Bargsten February 2012.

The bonobo genome compared with the chimpanzee and human genomes Kay Pruüfer et al. Nature (June,2012) Presenter: Chia-Ying Chen.

A Look into the Process of Marker Development Matt Robinson.

Cloning lab results Cloning the human genome Physical map of the chromosomes Genome sequencing Integrating physical and recombination maps Polymorphic.

9 Genomics and Beyond Brief Chapter Outline

Physical Mapping I CIS 667 February 26, Physical Mapping A physical map of a piece of DNA tells us the location of certain markers  A marker is.

The role of parallel genetic changes in domestication: Fruit size in the plant family Solanaceae Matt Robinson.

BACKGROUND E. coli is a free living, gram negative bacterium which colonizes the lower gut of animals. Since it is a model organism, a lot of experimental.

Genetic and physical maps around the sex-determining M- locus of the dioecious plant asparagus Telgmann-Rauber et al

Genome sequencing. Vocabulary Bac: Bacterial Artificial Chromosome: cloning vector for yeast Pac, cosmid, fosmid, plasmid: cloning vectors for E. coli.

Genome Analysis Determine locus & sequence of all the organism’s genes More than 100 genomes have been analysed including humans in the Human Genome Project.

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.

Comparison of Drosophila Genomes Li-Lun, Ho. D. melanogaster vs. D. yakuba D. yakuba genome is assembled in Apr, D. yakuba genome has 14 times higher.

Dept. of Plant Breeding & Genetics, Cornell University

Mouse Genome Sequencing

AP Biology Ch. 20 Biotechnology.

SOL Genomics Network Formed in 2003 to answer two questions: – How can a common set of genes give rise to such a wide range of morphologically and ecologically.

What is comparative genomics? Analyzing & comparing genetic material from different species to study evolution, gene function, and inherited disease Understand.

Screening a Library Plate out library on nutrient agar in petri dishes. Up to 50,000 plaques or colonies per plate.

Fig Chapter 12: Genomics. Genomics: the study of whole-genome structure, organization, and function Structural genomics: the physical genome; whole.

Information System for Comparative Analysis of Legume Genomes Anita Dalwani Advisors: Dr. Roger Innes, Dr. Haixu Tang.

BASIC FACTS ABOUT MALARIA n Four Plasmodium species cause human malaria: P. falciparum (the most virulent), P. vivax, P. malariae, and P. ovale. Human.

Genome sequencing Haixu Tang School of Informatics.

20.1 Structural Genomics Determines the DNA Sequences of Entire Genomes The ultimate goal of genomic research: determining the ordered nucleotide sequences.

Genome Sequencing in the Legumes Le et al Phylogeny Major sequencing efforts Minor sequencing efforts ~14 MY ~45 MY.

CS177 Lecture 10 SNPs and Human Genetic Variation

DNA Technology. Overview DNA technology makes it possible to clone genes for basic research and commercial applications DNA technology is a powerful set.

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.

Ch. 21 Genomes and their Evolution. New approaches have accelerated the pace of genome sequencing The human genome project began in 1990, using a three-stage.

1 Commentary 1.Do not get too worried about "methods" and details. I fully expect there to be concepts and techniques that you simply are not going to.

Anatomy of a Genome Project A.Sequencing 1. De novo vs. ‘resequencing’ 2.Sanger WGS versus ‘next generation’ sequencing 3.High versus low sequence coverage.

1 Genome Evolution Chapter Introduction Genomes contain the raw material for evolution; Comparing whole genomes enhances – Our ability to understand.

Genetic Diversity Biology/Env S 204 Spring Genetic diversity Heritable variation within and between populations of organisms Encoded in the sequence.

Chapter 24: Molecular and Genomic Evolution CHAPTER 24 Molecular and Genomic Evolution.

Chapter 5 The Content of the Genome 5.1 Introduction genome – The complete set of sequences in the genetic material of an organism. –It includes the.

Biology 1060 Chapter 20 DNA Technology and Genomics.

Cédric Notredame (08/12/2015) Molecular Evolution Cédric Notredame.

CHROMOSOMAL INVERSIONS IN HUMAN POPULATIONS Andrea González Morales.

Genomics Chapter 18.

Chapter 20 DNA Technology and Genomics. Biotechnology is the manipulation of organisms or their components to make useful products. Recombinant DNA is.

Mojavensis: Issues of Polymorphisms Chris Shaffer GEP 2009 Washington University.

Gene Technologies and Human ApplicationsSection 3 Section 3: Gene Technologies in Detail Preview Bellringer Key Ideas Basic Tools for Genetic Manipulation.

US Contribution to the International Tomato Genome Sequencing Effort Current structure of contributions Ongoing activity summary Funding issues.

Comparative maps of potato, eggplant, pepper and Nicotiana with respect to the tomato genome Silvana Grandillo CNR-IGV, Portici (Naples), Italy March 4,

A high-resolution map of human evolutionary constraints using 29 mammals Kerstin Lindblad-Toh et al Presentation by Robert Lewis and Kaylee Wells.

Genome Analysis. This involves finding out the: order of the bases in the DNA location of genes parts of the DNA that controls the activity of the genes.

Comparative Gene Mapping

SNP Detection Congtam Pham 2/24/04 Dr. Marth’s Class.

Aim: How do scientists use biotechnology to manipulate genomes?

Detection of the footprint of natural selection in the genome

Lesson Overview 17.4 Molecular Evolution.

Reads aligned into contigs

Pre-genomic era: finding your own clones

Section 3: Gene Technologies in Detail

DNA-based technology New and old technologies that are utilized in biotechnology DNA cloning DNA libraries Polymerase chain reaction (PCR) Genome sequencing.

Genome Projects Maps Human Genome Mapping Human Genome Sequencing

Fig Figure 21.1 What genomic information makes a human or chimpanzee?

Meiosis & Sexual Life Cycles

Potato Genome Project Structural Genomics 2.Functional Genomics

Chapter 6 Clusters and Repeats.

Polymorphism discovery in 09-CB1 × IPO323 versus 09-ASA-3apz × IPO94269 bulks. Polymorphism discovery in 09-CB1 × IPO323 versus 09-ASA-3apz × IPO94269.

Sex Chromosome Specialization and Degeneration in Mammals

Witness to Evolution

Higher Biology Unit 1: 1.7 Evolution.

Genomic location of 11 genes in relation to the CTD-2019C10 BAC clone.

Volume 23, Issue 10, Pages (May 2013)

Presentation transcript:

Evolving Resistance: Research Goals and Goods Georgiana May Brett Couch Ethy Cannon University of Minnesota

Education Training Evolution Map Resistance Resources

Ever since Grube et al. Chromosome 11S I2 R3,7 RB Grube et al. assembled data suggesting that the rapid rearrangment model is not supported and that chromoosomal locations of R genes are conserved RB

I2- homologous sequences in Solanaceae Tomato Potato S. dem. Eggplant Pepper Tobacco Couch et al. MPMI 2006

I2- h NBS sequences under positive selection

NBS LRR NBS and LRR regions reassociate through time

Contributions and resources Birth-death model applies to R gene evolution 232 sequences from 6 species positive selection evolving function? seek new resistance function in fewer than 10 lineages Brett Couch David Schladt

I2 lineages maintained 12 million years Ancient duplications

Contributions and resources Long term maintenance of R gene lineages - 12 my 232 sequences from 6 species maintained through speciation maintain function? seek non-host R in fewer than 10 lineages Brett Couch

I2-h map to chromosomes 8,9,11 in tomato B B B B B IL Block B BAC contig

250 tomato BAC clones hybridized to I2 probes Oligo probes hybridize to specifc I2 homologs

Map I2-containing BAC clones to IL segment PCR length polymorphisms in parent lines BAC end polymorphisms segregate in the L. pinnellii mapping population

Contributions and resources Verified Pan, Fluhr results chromosomes 8,9,11 not on 3,4 (Pan) New region - 9 I Ancient chromosomal duplications carry R gene duplications Brett Couch Deren Eaton

Conceptualimportance: Birth-Death = recombining and long term maintenance = non-recombining? Informatic - characteristics of genes that are of value to agriculture How to find them using evolutionary analyses and where are they likely to reside in the genome? Baumgarten et al. 2002 R

Goods solevol demo site http://www.medicago.org/ Ethalinda Cannon

examples

Resistance Resources 75 distinct I2-h lineages Genome locations over 6 species http://solevol.ccgb.umn.edu/ Genome locations Development of evolutionary models Training

Education Training Evolution Map Resistance Resources